Rh5CG562300

Calcium-dependent protein kinase

Basic Information

Type: gene
Biological Identity
rosa_samantha
Chr5C
Physical Location & Seq
Reverse (-)
78932129 .. 78934356
2228 bp
Loading structure...
UTR
Exon/CDS
Intron
Rh5CG562300.1

Sequence Viewer

Length: 264 bp
ATGATGCTCTTAATTGTTGCAGGAGTGTCACGGCATTTAGCAAGTAGTAATTCTACTCAACCTGCAGAAATTGATGAAATGAGAGGAATGGATCATCAGATTAAATCAAGAAGGTCAAGAAGGTGGAAACAAGCTCATCTGAGGTTCCCATCTGATCCCTGGGATGGCATCGCTGAATTAGCTAATGATTTGATTCGAGGAATGCTCTGTGAAGGTCCTTCTAAAAGGCTCACCGCTCACCAGAAGCTAGAGCCTGAAATTTGA
Functional Annotation
Pfam Domains
Protein Families

Protein Analysis

87

Amino Acids

9.92

Weight (kDa)

9.1

Isoelectric Point (pI)

63.94

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
Acc36I ACCTGC 1 cut(s) 70
AccBSI CCGCTC 1 cut(s) 236
AciI CCGC 1 cut(s) 234
AclWI GGATC 2 cut(s) 99, 149
AcsI RAATTY 1 cut(s) 258
AfiI CCNNNNNNNGG 1 cut(s) 164
AjnI CCWGG 1 cut(s) 158
AluBI AGCT 3 cut(s) 134, 182, 247
AluI AGCT 3 cut(s) 134, 182, 247
AlwI GGATC 2 cut(s) 99, 149
ApoI RAATTY 1 cut(s) 258
AspS9I GGNCC 1 cut(s) 215
AsuHPI GGTGA 2 cut(s) 223, 230
AvaII GGWCC 1 cut(s) 215
BccI CCATC 2 cut(s) 157, 158
BceAI ACGGC 1 cut(s) 47
BciT130I CCWGG 1 cut(s) 160
BfaI CTAG 1 cut(s) 248
BfmI CTRYAG 1 cut(s) 63
BfuAI ACCTGC 1 cut(s) 70
Bme1390I CCNGG 1 cut(s) 160
Bme18I GGWCC 1 cut(s) 215
BmgT120I GGNCC 1 cut(s) 215
BmiI GGNNCC 1 cut(s) 146
BmrFI CCNGG 1 cut(s) 160
BmsI GCATC 1 cut(s) 177
BplI GAGNNNNNCTC 2 cut(s) 189, 221
BsaJI CCNNGG 2 cut(s) 158, 159
Bsc4I CCNNNNNNNGG 1 cut(s) 164
BseBI CCWGG 1 cut(s) 160
BseDI CCNNGG 2 cut(s) 158, 159
BseGI GGATG 1 cut(s) 169
BseLI CCNNNNNNNGG 1 cut(s) 164
BseMII CTCAG 1 cut(s) 131
BslI CCNNNNNNNGG 1 cut(s) 164
BsmI GAATGC 1 cut(s) 207
Bsp143I GATC 2 cut(s) 91, 154
BspACI CCGC 1 cut(s) 234
BspCNI CTCAG 1 cut(s) 132
BspLI GGNNCC 1 cut(s) 146
BspMAI CTGCAG 1 cut(s) 67
BspMI ACCTGC 1 cut(s) 70
BspPI GGATC 2 cut(s) 99, 149
BsrBI CCGCTC 1 cut(s) 236
BssECI CCNNGG 2 cut(s) 158, 159
BssMI GATC 2 cut(s) 91, 154
Bst2UI CCWGG 1 cut(s) 160
BstDEI CTNAG 1 cut(s) 140
BstF5I GGATG 1 cut(s) 169
BstKTI GATC 2 cut(s) 94, 157
BstMBI GATC 2 cut(s) 91, 154
BstMWI GCNNNNNNNGC 1 cut(s) 179
BstNI CCWGG 1 cut(s) 160
BstSCI CCNGG 1 cut(s) 158
BstSFI CTRYAG 1 cut(s) 63
BtgZI GCGATG 1 cut(s) 154
BtsCI GGATG 1 cut(s) 169
BveI ACCTGC 1 cut(s) 70
Cfr13I GGNCC 1 cut(s) 215
CviJI RGCY 5 cut(s) 134, 182, 229, 247, 253
CviKI_1 RGCY 5 cut(s) 134, 182, 229, 247, 253
DdeI CTNAG 1 cut(s) 140
DpnI GATC 2 cut(s) 93, 156
DpnII GATC 2 cut(s) 91, 154
Eco47I GGWCC 1 cut(s) 215
EcoO109I RGGNCCY 1 cut(s) 215
EcoRII CCWGG 1 cut(s) 158
FokI GGATG 1 cut(s) 176
FspBI CTAG 1 cut(s) 248
HinfI GANTC 1 cut(s) 193
HphI GGTGA 2 cut(s) 223, 230
Hpy188I TCNGA 3 cut(s) 99, 141, 154
Hpy188III TCNNGA 2 cut(s) 108, 117
HpyAV CCTTC 4 cut(s) 105, 114, 206, 228
HpyCH4V TGCA 2 cut(s) 20, 65
HpyF10VI GCNNNNNNNGC 1 cut(s) 179
HpyF3I CTNAG 1 cut(s) 140
Kzo9I GATC 2 cut(s) 91, 154
LpnPI CCDG 5 cut(s) 6, 75, 145, 172, 254
LweI GCATC 1 cut(s) 177
MaeI CTAG 1 cut(s) 248
MaeIII GTNAC 1 cut(s) 27
MalI GATC 2 cut(s) 93, 156
MbiI CCGCTC 1 cut(s) 236
MboI GATC 2 cut(s) 91, 154
MluCI AATT 5 cut(s) 12, 49, 69, 176, 258
MnlI CCTC 3 cut(s) 77, 135, 191
MseI TTAA 2 cut(s) 11, 102
MspR9I CCNGG 1 cut(s) 160
Mva1269I GAATGC 1 cut(s) 207
MvaI CCWGG 1 cut(s) 160
MwoI GCNNNNNNNGC 1 cut(s) 179
NdeII GATC 2 cut(s) 91, 154
NlaIV GGNNCC 1 cut(s) 146
NmuCI GTSAC 1 cut(s) 27
PasI CCCWGGG 1 cut(s) 159
PctI GAATGC 1 cut(s) 207
PfeI GAWTC 1 cut(s) 193
PpuMI RGGWCCY 1 cut(s) 215
Psp5II RGGWCCY 1 cut(s) 215
Psp6I CCWGG 1 cut(s) 158
PspGI CCWGG 1 cut(s) 158
PspN4I GGNNCC 1 cut(s) 146
PspPI GGNCC 1 cut(s) 215
PspPPI RGGWCCY 1 cut(s) 215
PstI CTGCAG 1 cut(s) 67
SaqAI TTAA 2 cut(s) 11, 102
Sau3AI GATC 2 cut(s) 91, 154
Sau96I GGNCC 1 cut(s) 215
ScrFI CCNGG 1 cut(s) 160
SetI ASST 8 cut(s) 64, 116, 125, 136, 146, 184, 217, 249
SfaNI GCATC 1 cut(s) 177
SfcI CTRYAG 1 cut(s) 63
SinI GGWCC 1 cut(s) 215
Sse9I AATT 5 cut(s) 12, 49, 69, 176, 258
SsiI CCGC 1 cut(s) 234
SspMI CTAG 1 cut(s) 248
StyD4I CCNGG 1 cut(s) 158
TaqI TCGA 1 cut(s) 196
TasI AATT 5 cut(s) 12, 49, 69, 176, 258
TfiI GAWTC 1 cut(s) 193
Tru1I TTAA 2 cut(s) 11, 102
Tru9I TTAA 2 cut(s) 11, 102
TseFI GTSAC 1 cut(s) 27
Tsp45I GTSAC 1 cut(s) 27
TspDTI ATGAA 1 cut(s) 90
VpaK11BI GGWCC 1 cut(s) 215
XapI RAATTY 1 cut(s) 258
XcmI CCANNNNNNNNNTGG 1 cut(s) 156
XspI CTAG 1 cut(s) 248
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.