Rh2AG344700

B3 domain-containing protein

Design Primers CRISPR Design

Basic Information

Type: gene
Biological Identity
rosa_samantha
Chr2A
OG0000535
Physical Location & Seq
Forward (+)
50649599 .. 50669240
19642 bp
Loading structure...
UTR
Exon/CDS
Intron
Rh2AG344700.1

Sequence Viewer

Length: 429 bp
ATGTCGGGAAAGAGACCTGCTAATGGTTACTTAGAAGAAACATCAGATGGATCCATCTTGTTCAAATCGGAGAATTCATGTTTTCAAAGAATTTTGACAAAGCATTCAAAATATCACATTGGGTTTCCAAAAGAACTCGGTGTAGCTAAAGGTCTTATGAATGAGAAGACCATGAAGCTTGAAAATCCAACTGGGAGATCATGGCCTGCTCTTGGTGATGATAACTTGAACAGAGATTTTGCTGTACAACAGGGATATGTTGACTATCTTGGTTTAGGAAATTGCTGGTTTTGGGTGCTTTATTATGCAGGTCTGAGGACTATTGATAGTATATTAGATGACCTTGAAAGGGAGATTGATAATGGAGTGAACACTTACCAGGCAATGTGGAATGATAGCCCGAAACAGGATGATATCACTATGCTATAG
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families
B3

Protein Analysis

142

Amino Acids

16.19

Weight (kDa)

4.97

Isoelectric Point (pI)

45.24

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready
iTOL Interactive Tree Of Life · Most popular EvolView Flexible annotations MEGA Desktop phylogenetics suite FigTree Desktop tree editor

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
Acc36I ACCTGC 2 cut(s) 25, 299
AclWI GGATC 2 cut(s) 45, 58
AcsI RAATTY 2 cut(s) 73, 90
AfaI GTAC 1 cut(s) 246
AfiI CCNNNNNNNGG 4 cut(s) 23, 212, 349, 406
AgsI TTSAA 6 cut(s) 64, 86, 108, 182, 229, 347
AjnI CCWGG 1 cut(s) 378
AluBI AGCT 2 cut(s) 146, 178
AluI AGCT 2 cut(s) 146, 178
Alw26I GTCTC 1 cut(s) 7
AlwI GGATC 2 cut(s) 45, 58
AoxI GGCC 1 cut(s) 203
ApoI RAATTY 2 cut(s) 73, 90
AsuHPI GGTGA 1 cut(s) 227
BamHI GGATCC 1 cut(s) 50
BbsI GAAGAC 1 cut(s) 173
BccI CCATC 2 cut(s) 41, 62
BciT130I CCWGG 1 cut(s) 380
BcoDI GTCTC 1 cut(s) 7
BfmI CTRYAG 1 cut(s) 425
BfuAI ACCTGC 2 cut(s) 25, 299
Bme1390I CCNGG 1 cut(s) 380
BmiI GGNNCC 1 cut(s) 52
BmrFI CCNGG 1 cut(s) 380
BmrI ACTGGG 1 cut(s) 201
BmuI ACTGGG 1 cut(s) 201
BpiI GAAGAC 1 cut(s) 173
BsaI GGTCTC 1 cut(s) 7
Bsc4I CCNNNNNNNGG 4 cut(s) 23, 212, 349, 406
Bse1I ACTGG 1 cut(s) 196
Bse3DI GCAATG 1 cut(s) 390
BseBI CCWGG 1 cut(s) 380
BseGI GGATG 1 cut(s) 415
BseLI CCNNNNNNNGG 4 cut(s) 23, 212, 349, 406
BseMI GCAATG 1 cut(s) 390
BseMII CTCAG 1 cut(s) 305
BseNI ACTGG 1 cut(s) 196
BshFI GGCC 1 cut(s) 205
BslI CCNNNNNNNGG 4 cut(s) 23, 212, 349, 406
BsmAI GTCTC 1 cut(s) 7
BsmI GAATGC 1 cut(s) 103
BsnI GGCC 1 cut(s) 205
Bso31I GGTCTC 1 cut(s) 7
Bsp1407I TGTACA 1 cut(s) 244
Bsp143I GATC 2 cut(s) 50, 197
BspANI GGCC 1 cut(s) 205
BspCNI CTCAG 1 cut(s) 306
BspLI GGNNCC 1 cut(s) 52
BspMI ACCTGC 2 cut(s) 25, 299
BspPI GGATC 2 cut(s) 45, 58
BspTNI GGTCTC 1 cut(s) 7
BsrDI GCAATG 1 cut(s) 390
BsrGI TGTACA 1 cut(s) 244
BsrI ACTGG 1 cut(s) 196
BssMI GATC 2 cut(s) 50, 197
Bst2UI CCWGG 1 cut(s) 380
BstAUI TGTACA 1 cut(s) 244
BstC8I GCNNGC 1 cut(s) 207
BstDEI CTNAG 2 cut(s) 31, 314
BstF5I GGATG 1 cut(s) 415
BstKTI GATC 2 cut(s) 53, 200
BstMAI GTCTC 1 cut(s) 7
BstMBI GATC 2 cut(s) 50, 197
BstNI CCWGG 1 cut(s) 380
BstSCI CCNGG 1 cut(s) 378
BstSFI CTRYAG 1 cut(s) 425
BstV2I GAAGAC 1 cut(s) 173
BstX2I RGATCY 1 cut(s) 50
BstYI RGATCY 1 cut(s) 50
BsuRI GGCC 1 cut(s) 205
BtsCI GGATG 1 cut(s) 415
BveI ACCTGC 2 cut(s) 25, 299
Cac8I GCNNGC 1 cut(s) 207
Csp6I GTAC 1 cut(s) 245
CviAII CATG 3 cut(s) 78, 172, 201
CviJI RGCY 4 cut(s) 146, 178, 205, 399
CviKI_1 RGCY 4 cut(s) 146, 178, 205, 399
CviQI GTAC 1 cut(s) 245
DdeI CTNAG 2 cut(s) 31, 314
DpnI GATC 2 cut(s) 52, 199
DpnII GATC 2 cut(s) 50, 197
Eco31I GGTCTC 1 cut(s) 7
Eco32I GATATC 1 cut(s) 415
EcoRI GAATTC 1 cut(s) 73
EcoRII CCWGG 1 cut(s) 378
EcoRV GATATC 1 cut(s) 415
FaeI CATG 3 cut(s) 81, 175, 204
FaiI YATR 9 cut(s) 79, 158, 173, 202, 258, 306, 332, 422, 427
FatI CATG 3 cut(s) 77, 171, 200
FokI GGATG 1 cut(s) 422
HaeIII GGCC 1 cut(s) 205
Hin1II CATG 3 cut(s) 81, 175, 204
HincII GTYRAC 1 cut(s) 262
HindII GTYRAC 1 cut(s) 262
HindIII AAGCTT 1 cut(s) 176
HphI GGTGA 1 cut(s) 227
Hpy166II GTNNAC 2 cut(s) 262, 370
Hpy188I TCNGA 3 cut(s) 46, 70, 315
Hpy188III TCNNGA 1 cut(s) 6
Hpy8I GTNNAC 2 cut(s) 262, 370
HpyCH4V TGCA 1 cut(s) 308
HpyF3I CTNAG 2 cut(s) 31, 314
Hsp92II CATG 3 cut(s) 81, 175, 204
Kzo9I GATC 2 cut(s) 50, 197
LpnPI CCDG 9 cut(s) 30, 177, 219, 236, 271, 294, 365, 392, 392
MaeIII GTNAC 1 cut(s) 26
MalI GATC 2 cut(s) 52, 199
MboI GATC 2 cut(s) 50, 197
MboII GAAGA 2 cut(s) 47, 178
MflI RGATCY 1 cut(s) 50
MluCI AATT 3 cut(s) 73, 90, 280
MmeI TCCRAC 1 cut(s) 212
MnlI CCTC 1 cut(s) 309
MspR9I CCNGG 1 cut(s) 380
Mva1269I GAATGC 1 cut(s) 103
MvaI CCWGG 1 cut(s) 380
NdeII GATC 2 cut(s) 50, 197
NlaIII CATG 3 cut(s) 81, 175, 204
NlaIV GGNNCC 1 cut(s) 52
PctI GAATGC 1 cut(s) 103
Psp6I CCWGG 1 cut(s) 378
PspGI CCWGG 1 cut(s) 378
PspN4I GGNNCC 1 cut(s) 52
PsuI RGATCY 1 cut(s) 50
RsaI GTAC 1 cut(s) 246
RsaNI GTAC 1 cut(s) 245
Sau3AI GATC 2 cut(s) 50, 197
ScrFI CCNGG 1 cut(s) 380
SetI ASST 6 cut(s) 19, 148, 154, 180, 313, 345
SfcI CTRYAG 1 cut(s) 425
Sse9I AATT 3 cut(s) 73, 90, 280
StyD4I CCNGG 1 cut(s) 378
TasI AATT 3 cut(s) 73, 90, 280
TatI WGTACW 1 cut(s) 244
TspDTI ATGAA 3 cut(s) 66, 173, 188
XapI RAATTY 2 cut(s) 73, 90
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.