Rh6AG015700

Belongs to the iron ascorbate-dependent oxidoreductase family

Design Primers CRISPR Design

Basic Information

Type: gene
Biological Identity
rosa_samantha
Chr6A
OG0000451
Physical Location & Seq
Forward (+)
1590431 .. 1590670
240 bp
Loading structure...
UTR
Exon/CDS
Intron
Rh6AG015700.1

Sequence Viewer

Length: 240 bp
ATGGGAAGTACGTACAAGAGCATTGAACATAGAGCTGTGACGAACAAAAGCAAGGCAAGATTATCTTATGCAACATTTATAATTCCACGTAACGATGTTGAAATTGGACCATTTAATCATTTAGTGGACCAGTCATCTCGAAAGTACAAGAAAGTCATATACGGAGAATATTTGAGGAGTTCCTTGAAGGGAAAACTTGAGGGGAAGTCGCACACTGAAACAACAAAGATCGGAAGTTAA
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families
2OG-FeII_Oxy DIOX_N Thaumatin

Protein Analysis

79

Amino Acids

8.95

Weight (kDa)

9.94

Isoelectric Point (pI)

35.08

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready
iTOL Interactive Tree Of Life · Most popular EvolView Flexible annotations MEGA Desktop phylogenetics suite FigTree Desktop tree editor

Orthologous Genes (Group: OG0000451)

Species Orthologous Gene IDs
fragaria_vesca FvH4_6g13280 FvH4_6g13281 FvH4_6g13290 FvH4_6g13290 FvH4_6g13290 FvH4_6g13290 FvH4_6g13300 FvH4_6g13322
malus_domestica MD04G1132000.v1.1 MD04G1132100.v1.1 MD04G1132400.v1.1 MD12G1145100.v1.1 MD12G1145200.v1.1
prunus_persica Prupe.6G258600_v2.0.a1 Prupe.6G258700_v2.0.a1 Prupe.6G258800_v2.0.a1 Prupe.6G258800_v2.0.a1 Prupe.6G258900_v2.0.a1
pyrus_communis pycom04g12010 pycom04g12020
rosa_chinensis RchiOBHm_Chr3g0466131 RchiOBHm_Chr3g0466151 RchiOBHm_Chr3g0466161 RchiOBHm_Chr3g0466171 RchiOBHm_Chr3g0466181 RchiOBHm_Chr3g0466201 RchiOBHm_Chr3g0466211 RchiOBHm_Chr6g0251841
rosa_laevigata RLG00000015425 RLG00000024596 RLG00000024599 RLG00000024600 RLG00000024601 RLG00000024602
rosa_multiflora Rmu_co8112718.1_g000001 Rmu_co8178858.1_g000001 Rmu_co8388385.1_g000001 Rmu_sc0000350.1_g000002 Rmu_sc0000350.1_g000003 Rmu_sc0000350.1_g000004 Rmu_sc0000350.1_g000006 Rmu_sc0000350.1_g000011 Rmu_sc0002249.1_g000004 Rmu_sc0007597.1_g000012 Rmu_sc0012177.1_g000002 Rmu_sc0012177.1_g000006 Rmu_sc0012177.1_g000007 Rmu_sc0022084.1_g000003 Rmu_ssc0000303.1_g000004
rosa_roxburghii Rroxscaffold_6G00414720 Rroxscaffold_6G00414730 Rroxscaffold_6G00414740 Rroxscaffold_6G00414750 Rroxscaffold_6G00414760 Rroxscaffold_6G00414770 Rroxscaffold_6G00414780 Rroxscaffold_6G00414790
rosa_rugosa Rorug03G0079600 Rorug03G0079600 Rorug03G0079800 Rorug03G0080100 Rorug03G0080200 Rorug03G0080300 Rorug03G0080400 Rorug05G0504900
rosa_samantha Rh3BG147200 Rh3BG147300 Rh3BG147400 Rh3BG147500 Rh3BG147600 Rh3CG147900 Rh3CG148000 Rh3CG148100 Rh3CG148200 Rh3CG148300 Rh3CG148500 Rh3CG148600 Rh3DG147800 Rh3DG147900 Rh3DG148100 Rh3DG148300 Rh4BG237100 Rh6AG015600 Rh6AG015700 Rh6BG013700 Rh6CG069500
rosa_wichuraiana Rw3G011870 Rw3G011880 Rw3G011890 Rw3G011900 Rw3G011910 Rw3G011930 Rw6G001500

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AanI TTATAA 1 cut(s) 80
AfaI GTAC 3 cut(s) 10, 14, 146
AgsI TTSAA 3 cut(s) 26, 101, 187
AluBI AGCT 1 cut(s) 35
AluI AGCT 1 cut(s) 35
AspS9I GGNCC 2 cut(s) 107, 127
AvaII GGWCC 2 cut(s) 107, 127
Bme18I GGWCC 2 cut(s) 107, 127
BmgT120I GGNCC 2 cut(s) 107, 127
BpuEI CTTGAG 1 cut(s) 218
BsaAI YACGTR 2 cut(s) 12, 89
Bse1I ACTGG 1 cut(s) 130
BseNI ACTGG 1 cut(s) 130
BseRI GAGGAG 1 cut(s) 190
Bsp143I GATC 1 cut(s) 228
BsrI ACTGG 1 cut(s) 130
BssMI GATC 1 cut(s) 228
BstBAI YACGTR 2 cut(s) 12, 89
BstKTI GATC 1 cut(s) 231
BstMBI GATC 1 cut(s) 228
BstSNI TACGTA 1 cut(s) 12
BtsIMutI CAGTG 1 cut(s) 213
Cfr13I GGNCC 2 cut(s) 107, 127
Csp6I GTAC 3 cut(s) 9, 13, 145
CviJI RGCY 1 cut(s) 35
CviKI_1 RGCY 1 cut(s) 35
CviQI GTAC 3 cut(s) 9, 13, 145
DpnI GATC 1 cut(s) 230
DpnII GATC 1 cut(s) 228
Eco105I TACGTA 1 cut(s) 12
Eco47I GGWCC 2 cut(s) 107, 127
FaiI YATR 5 cut(s) 30, 69, 80, 158, 160
FalI AAGNNNNNCTT 2 cut(s) 49, 81
Hpy166II GTNNAC 1 cut(s) 127
Hpy188I TCNGA 1 cut(s) 233
Hpy188III TCNNGA 1 cut(s) 138
Hpy8I GTNNAC 1 cut(s) 127
HpyAV CCTTC 1 cut(s) 181
HpyCH4IV ACGT 2 cut(s) 11, 88
HpyCH4V TGCA 1 cut(s) 71
HpySE526I ACGT 2 cut(s) 11, 88
Kzo9I GATC 1 cut(s) 228
LpnPI CCDG 1 cut(s) 143
MaeII ACGT 2 cut(s) 11, 88
MaeIII GTNAC 2 cut(s) 37, 89
MalI GATC 1 cut(s) 230
MboI GATC 1 cut(s) 228
MluCI AATT 2 cut(s) 81, 102
MnlI CCTC 2 cut(s) 168, 193
MseI TTAA 2 cut(s) 114, 238
NdeII GATC 1 cut(s) 228
NmuCI GTSAC 1 cut(s) 37
Ppu21I YACGTR 2 cut(s) 12, 89
PsiI TTATAA 1 cut(s) 80
PspPI GGNCC 2 cut(s) 107, 127
RsaI GTAC 3 cut(s) 10, 14, 146
RsaNI GTAC 3 cut(s) 9, 13, 145
SaqAI TTAA 2 cut(s) 114, 238
Sau3AI GATC 1 cut(s) 228
Sau96I GGNCC 2 cut(s) 107, 127
SetI ASST 3 cut(s) 14, 37, 91
SgeI CNNG 9 cut(s) 28, 64, 69, 99, 142, 150, 160, 196, 209
SinI GGWCC 2 cut(s) 107, 127
SmlI CTYRAG 1 cut(s) 197
SmoI CTYRAG 1 cut(s) 197
SnaBI TACGTA 1 cut(s) 12
Sse9I AATT 2 cut(s) 81, 102
SspI AATATT 1 cut(s) 170
TaiI ACGT 2 cut(s) 14, 91
TaqI TCGA 1 cut(s) 139
TasI AATT 2 cut(s) 81, 102
TatI WGTACW 1 cut(s) 144
Tru1I TTAA 2 cut(s) 114, 238
Tru9I TTAA 2 cut(s) 114, 238
TscAI CASTG 1 cut(s) 220
TseFI GTSAC 1 cut(s) 37
Tsp45I GTSAC 1 cut(s) 37
TspGWI ACGGA 1 cut(s) 177
TspRI CASTG 1 cut(s) 220
VpaK11BI GGWCC 2 cut(s) 107, 127
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.