Rh7BG420100

hydrolase activity, acting on ester bonds

Basic Information

Type: gene
Biological Identity
rosa_samantha
Chr7B
Physical Location & Seq
Forward (+)
47674992 .. 47675712
721 bp
Loading structure...
UTR
Exon/CDS
Intron
Rh7BG420100.1

Sequence Viewer

Length: 213 bp
ATGAGTACTATAGTAGTAGCTGAAGCTGGGGACCGACCAGCTGATGAAATCAACAGAATGTCGTCACCGTTCGTAGGGGTTTTCGCCTTTGGAGATTCGGTTCTTGATACAGGCAACAACAATTACCTCCCTACTGCAGGCAAATGCAATTTCCCACCCTATGGAAAAGATTTCACCGGAGGCATCCCAACGGGAAAGTTTACTCCGACTTAA
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families

Protein Analysis

70

Amino Acids

7.36

Weight (kDa)

4.6

Isoelectric Point (pI)

33.8

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Orthologous Genes (Group: OG0000393)

Species Orthologous Gene IDs
arabidopsis_thaliana AT1G20120 AT1G20132
fragaria_vesca FvH4_1g11330 FvH4_1g11340 FvH4_1g11341 FvH4_1g11342 FvH4_1g11390 FvH4_1g11390 FvH4_2g38111 FvH4_2g38111 FvH4_2g38111 FvH4_5g34670
malus_domestica MD02G1126900.v1.1 MD02G1127000.v1.1 MD02G1127100.v1.1 MD15G1008700.v1.1 MD15G1241600.v1.1 MD15G1241700.v1.1
prunus_persica Prupe.1G361600_v2.0.a1 Prupe.1G361700_v2.0.a1 Prupe.7G172300_v2.0.a1
pyrus_communis pycom02g09900 pycom02g09910 pycom02g09920 pycom15g00720 pycom15g21320
rosa_chinensis RchiOBHm_Chr2g0098851 RchiOBHm_Chr2g0098861 RchiOBHm_Chr2g0098871 RchiOBHm_Chr2g0098881 RchiOBHm_Chr2g0098921 RchiOBHm_Chr2g0130201 RchiOBHm_Chr6g0303431 RchiOBHm_Chr7g0235831
rosa_laevigata RLG00000001135 RLG00000011086 RLG00000016830 RLG00000016834 RLG00000019130
rosa_multiflora Rmu_co8160810.1_g000001 Rmu_co8282213.1_g000001 Rmu_co8476509.1_g000001 Rmu_sc0007686.1_g000001 Rmu_sc0008564.1_g000006 Rmu_sc0008564.1_g000009 Rmu_sc0008564.1_g000011 Rmu_sc0008564.1_g000016 Rmu_sc0008940.1_g000006 Rmu_sc0008941.1_g000009 Rmu_sc0010460.1_g000019 Rmu_sc0027015.1_g000001 Rmu_sc0027115.1_g000001 Rmu_sc0039572.1_g000001 Rmu_ssc0000114.1_g000053
rosa_roxburghii Rroxscaffold_2G00143590 Rroxscaffold_2G00143660 Rroxscaffold_2G00143670 Rroxscaffold_2G00143680 Rroxscaffold_7G00164780
rosa_rugosa Rorug02G0075000 Rorug02G0075100 Rorug02G0075200 Rorug02G0291100 Rorug02G0291200 Rorug02G0291300
rosa_samantha Rh2AG123000 Rh2AG123100 Rh2AG123200 Rh2AG123400 Rh2AG123800 Rh2AG123900 Rh2AG124200 Rh2AG124400 Rh2AG343000 Rh2BG126600 Rh2BG126700 Rh2BG126900 Rh2BG127100 Rh2BG127400 Rh2BG127600 Rh2BG350800 Rh2CG127600 Rh2CG127700 Rh2CG127800 Rh2CG128000 Rh2CG128300 Rh2CG128500 Rh2CG330100 Rh6AG435600 Rh6CG447600 Rh6DG434300 Rh7AG447900 Rh7BG420100 Rh7CG468400
rosa_wichuraiana Rw0G004290 Rw2G009510 Rw2G009550 Rw2G027630 Rw2G027650 Rw6G037700 Rw7G037230

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AccB7I CCANNNNNTGG 1 cut(s) 161
AcuI CTGAAG 1 cut(s) 42
AfaI GTAC 1 cut(s) 7
AfiI CCNNNNNNNGG 3 cut(s) 74, 137, 161
AloI GAACNNNNNNTCC 2 cut(s) 84, 116
AluBI AGCT 3 cut(s) 20, 26, 41
AluI AGCT 3 cut(s) 20, 26, 41
AspS9I GGNCC 1 cut(s) 31
AsuHPI GGTGA 2 cut(s) 57, 166
AvaII GGWCC 1 cut(s) 31
BfmI CTRYAG 2 cut(s) 9, 135
BmcAI AGTACT 1 cut(s) 7
Bme18I GGWCC 1 cut(s) 31
BmgT120I GGNCC 1 cut(s) 31
BmiI GGNNCC 1 cut(s) 32
BmsI GCATC 1 cut(s) 192
BsaWI WCCGGW 1 cut(s) 176
BsaXI ACNNNNNCTCC 2 cut(s) 84, 114
Bsc4I CCNNNNNNNGG 3 cut(s) 74, 137, 161
BseGI GGATG 1 cut(s) 183
BseLI CCNNNNNNNGG 3 cut(s) 74, 137, 161
BseYI CCCAGC 1 cut(s) 26
BsiSI CCGG 1 cut(s) 177
BslFI GGGAC 1 cut(s) 44
BslI CCNNNNNNNGG 3 cut(s) 74, 137, 161
BsmFI GGGAC 1 cut(s) 44
BspLI GGNNCC 1 cut(s) 32
BspMAI CTGCAG 1 cut(s) 139
Bst4CI ACNGT 1 cut(s) 69
BstC8I GCNNGC 1 cut(s) 139
BstENI CCTNNNNNAGG 1 cut(s) 135
BstF5I GGATG 1 cut(s) 183
BstSFI CTRYAG 2 cut(s) 9, 135
BtsCI GGATG 1 cut(s) 183
Cac8I GCNNGC 1 cut(s) 139
Cfr13I GGNCC 1 cut(s) 31
Csp6I GTAC 1 cut(s) 6
CviJI RGCY 3 cut(s) 20, 26, 41
CviKI_1 RGCY 3 cut(s) 20, 26, 41
CviQI GTAC 1 cut(s) 6
Eco47I GGWCC 1 cut(s) 31
Eco57I CTGAAG 1 cut(s) 42
EcoNI CCTNNNNNAGG 1 cut(s) 135
FaiI YATR 2 cut(s) 11, 162
FaqI GGGAC 1 cut(s) 44
FokI GGATG 1 cut(s) 170
GsaI CCCAGC 1 cut(s) 30
HapII CCGG 1 cut(s) 177
HinfI GANTC 1 cut(s) 95
HpaII CCGG 1 cut(s) 177
HphI GGTGA 2 cut(s) 57, 166
Hpy166II GTNNAC 1 cut(s) 201
Hpy188I TCNGA 1 cut(s) 207
Hpy188III TCNNGA 1 cut(s) 104
Hpy8I GTNNAC 1 cut(s) 201
HpyCH4III ACNGT 1 cut(s) 69
HpyCH4V TGCA 2 cut(s) 137, 147
LpnPI CCDG 5 cut(s) 12, 51, 96, 123, 190
LweI GCATC 1 cut(s) 192
MaeIII GTNAC 1 cut(s) 63
MluCI AATT 2 cut(s) 121, 148
MnlI CCTC 2 cut(s) 137, 173
MseI TTAA 1 cut(s) 211
MspA1I CMGCKG 1 cut(s) 41
MspI CCGG 1 cut(s) 177
NlaIV GGNNCC 1 cut(s) 32
NmuCI GTSAC 1 cut(s) 63
PfeI GAWTC 1 cut(s) 95
PflMI CCANNNNNTGG 1 cut(s) 161
PspFI CCCAGC 1 cut(s) 26
PspN4I GGNNCC 1 cut(s) 32
PspPI GGNCC 1 cut(s) 31
PstI CTGCAG 1 cut(s) 139
PvuII CAGCTG 1 cut(s) 41
RsaI GTAC 1 cut(s) 7
RsaNI GTAC 1 cut(s) 6
SaqAI TTAA 1 cut(s) 211
Sau96I GGNCC 1 cut(s) 31
ScaI AGTACT 1 cut(s) 7
SetI ASST 4 cut(s) 22, 28, 43, 129
SfaNI GCATC 1 cut(s) 192
SfcI CTRYAG 2 cut(s) 9, 135
SgeI CNNG 7 cut(s) 39, 50, 116, 123, 150, 189, 204
SinI GGWCC 1 cut(s) 31
Sse9I AATT 2 cut(s) 121, 148
TaaI ACNGT 1 cut(s) 69
TaqII GACCGA 1 cut(s) 48
TasI AATT 2 cut(s) 121, 148
TatI WGTACW 1 cut(s) 5
TfiI GAWTC 1 cut(s) 95
Tru1I TTAA 1 cut(s) 211
Tru9I TTAA 1 cut(s) 211
TseFI GTSAC 1 cut(s) 63
Tsp45I GTSAC 1 cut(s) 63
TspDTI ATGAA 1 cut(s) 60
Van91I CCANNNNNTGG 1 cut(s) 161
VpaK11BI GGWCC 1 cut(s) 31
XagI CCTNNNNNAGG 1 cut(s) 135
ZrmI AGTACT 1 cut(s) 7
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.