Rmu_sc0003808.1_g000016

Lignin degradation and detoxification of lignin-derived products

Basic Information

Type: gene
Biological Identity
rosa_multiflora
Rmu_sc0003808.1
Physical Location & Seq
Reverse (-)
84427 .. 86965
2539 bp
Loading structure...
UTR
Exon/CDS
Intron
Rmu_sc0003808.1_g000016.1.cds

Sequence Viewer

Length: 1824 bp
atgaaatccatgaagagtactactagtccagtactgatgtcgacacagtttctggtgttcgctgctcttattatcatcctaccgctcttcatctctctggctcgagcagaagttcattactacgattttatagttaaggaggtaaacttcactagattgtgtgaatcaaagctcatgttagtagtaaacgagagctatccaggtccagcaatacgagctcgcaaaggggatacaatttatgttaatgtttacaatcaaggattttatggtttcaccattcactggcatggagtaaagcaaccaagaaatccatggtttgatggcccagaatatgtgacacaatgcccaatatcaccgggaacaaattttacctatcaagttcagttgaccacagaagaaggaactctgtggtggcatgctcatagtgactggactagggcaagcgttcacggtgccattgtcatcttgcctgctcttggaacaacatttccatttcctgagcctgatgaagaggagatcattgtgttcggatcttggtatttgggaaatttgaaagaacaggttgacgagtgtctggaccctgcaaccaactctaacttacccatagcagctggttacacaattaatggccggcttggagatttttctccatgctccaaaaatacaacgtatcgtcgtaaggtggactatggcaagacatatcttcttcggatagtgaacgcaaacatcgatgtagagttttactttgccattgctgaacacaacctcactgtggttggcttggacggctcctataccaaacccatcaacacaggctatatagtgatagcccctggacaaacaatggacgtgttgctcaacacaaattcggctctggggagctattacatggtcggaagagaatacataagtgctacagttgacacagtatctgactctgcgaatgatgctattgcaatccttgaatataatggtaactataccacttccgaagctcctttatttccccaacaaattcccagttccttatcccaaacagatgcattcaacttctacggaaatattagaagcttagccaccccagagtatcctataaatgtcccaaaagagagcgacataactaccaaaatgtacataacagcttccgccaacgctctttattgtactccagatttaggtccctcatgcgtaaacatatcttttgctgcaagcgtcaataatatcagttgggtcaatccgagagaatctatcttacaagcctactacaggaacataagcgagccggtttatgaaacagattttccagacgaaccacctacttattttaacttcactgaaatagcgatgacactagatcgagtgttgacagtccaagggacaaaggtcaaggtgctagaatataatgaaacagttgagatggtgtttcaaggaactgatgtgatgggtggttccgtgaatcatccaatgcacttgcatggacatagcttttatgtgcttggatttggctttggggatttcttggcagagagagactcaaaaggttataatttgattgatcctccttacgtaacaacgtttataactcccaaaaacggatggttaaccatcagatttgtagcgaataatccaggtgtgtggttttggcattgtcacatggagagacacttgacatggggtatggagtctgcttttatagtgaagaacgggggcacaactgagactaatatgctcggtcctccagctatcttgccttcctgtgatgttccattggattctgctacaatcctaagtcacgcagaattgattaagaatcaaatagagtaa
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
Pfam Domains
Protein Families

Protein Analysis

607

Amino Acids

67.88

Weight (kDa)

5.01

Isoelectric Point (pI)

39.16

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Orthologous Genes (Group: OG0000320)

Species Orthologous Gene IDs
fragaria_vesca FvH4_2g12640 FvH4_2g18980 FvH4_2g18990 FvH4_2g40270 FvH4_2g40270 FvH4_4g22740 FvH4_4g22740 FvH4_5g35760 FvH4_5g35760 FvH4_5g35760 FvH4_5g35760 FvH4_5g35760 FvH4_5g35760 FvH4_5g35760 FvH4_5g35760 FvH4_5g36460 FvH4_5g36460 FvH4_6g39950 FvH4_6g39970 FvH4_6g39983 FvH4_6g39990
rosa_chinensis RchiOBHm_Chr2g0154481 RchiOBHm_Chr2g0154511 RchiOBHm_Chr4g0428961 RchiOBHm_Chr6g0252431 RchiOBHm_Chr6g0273301 RchiOBHm_Chr6g0273631 RchiOBHm_Chr6g0273651 RchiOBHm_Chr6g0284751 RchiOBHm_Chr6g0284761 RchiOBHm_Chr6g0300491 RchiOBHm_Chr7g0237421 RchiOBHm_Chr7g0238581
rosa_laevigata RLG00000000906 RLG00000001006 RLG00000007110 RLG00000011333 RLG00000012721 RLG00000013605 RLG00000013626 RLG00000020780 RLG00000020782 RLG00000020783 RLG00000020786
rosa_multiflora Rmu_co8321753.1_g000001 Rmu_sc0000239.1_g000020 Rmu_sc0000686.1_g000001 Rmu_sc0000686.1_g000003 Rmu_sc0000686.1_g000005 Rmu_sc0001476.1_g000011 Rmu_sc0002231.1_g000002 Rmu_sc0002231.1_g000016 Rmu_sc0002690.1_g000003 Rmu_sc0002717.1_g000015 Rmu_sc0002923.1_g000026 Rmu_sc0003808.1_g000016 Rmu_sc0006475.1_g000008 Rmu_sc0006475.1_g000012 Rmu_sc0006475.1_g000018 Rmu_sc0014815.1_g000004 Rmu_sc0015313.1_g000012
rosa_roxburghii Rroxscaffold_2G00094270 Rroxscaffold_2G00094290 Rroxscaffold_3G00222950 Rroxscaffold_3G00224250 Rroxscaffold_5G00370630 Rroxscaffold_7G00167740 Rroxscaffold_7G00184410 Rroxscaffold_7G00195190 Rroxscaffold_7G00195460
rosa_rugosa Rorug02G0444600 Rorug04G0231100 Rorug04G0231200 Rorug06G0074000 Rorug06G0076800 Rorug06G0166400 Rorug06G0166500 Rorug06G0166600 Rorug06G0296400 Rorug07G0303000
rosa_samantha Rh2CG494600 Rh2CG494700 Rh2DG530800 Rh2DG530900 Rh2DG531000 Rh4AG287500 Rh4AG403800 Rh4BG293400 Rh4BG415100 Rh4DG290500 Rh6AG191000 Rh6AG191300 Rh6BG192500 Rh6BG194800 Rh6BG195200 Rh6BG279500 Rh6BG279600 Rh6DG183900 Rh6DG186600 Rh6DG274300 Rh6DG274500 Rh6DG409500 Rh7AG460600 Rh7AG468200 Rh7BG430200
rosa_wichuraiana Rw2G041820 Rw2G041830 Rw2G041840 Rw4G024930 Rw6G016470 Rw6G016720 Rw6G016730 Rw6G024020 Rw6G024030 Rw6G035790 Rw7G038130

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AanI TTATAA 2 cut(s) 1545, 1580
AccB1I GGYRCC 1 cut(s) 452
AccB7I CCANNNNNTGG 1 cut(s) 282
AccBSI CCGCTC 1 cut(s) 85
AccI GTMKAC 1 cut(s) 41
AciI CCGC 2 cut(s) 83, 1146
AclI AACGTT 1 cut(s) 1574
AclWI GGATC 2 cut(s) 538, 1550
AcoI YGGCCR 1 cut(s) 628
AcsI RAATTY 4 cut(s) 364, 547, 865, 1014
AfaI GTAC 4 cut(s) 19, 33, 1133, 1165
AfiI CCNNNNNNNGG 6 cut(s) 282, 476, 772, 1175, 1266, 1592
AflIII ACRYGT 1 cut(s) 849
AgsI TTSAA 4 cut(s) 553, 965, 1048, 1427
AhlI ACTAGT 1 cut(s) 23
AjiI CACGTC 1 cut(s) 850
AjnI CCWGG 3 cut(s) 199, 832, 1627
AloI GAACNNNNNNTCC 2 cut(s) 472, 504
Alw21I GWGCWC 1 cut(s) 220
Alw26I GTCTC 3 cut(s) 1524, 1654, 1712
AlwI GGATC 2 cut(s) 538, 1550
AlwNI CAGNNNCTG 2 cut(s) 52, 932
Ama87I CYCGRG 1 cut(s) 102
AoxI GGCC 2 cut(s) 322, 628
ApeKI GCWGC 3 cut(s) 62, 608, 1205
ApoI RAATTY 4 cut(s) 364, 547, 865, 1014
AseI ATTAAT 1 cut(s) 624
AspS9I GGNCC 5 cut(s) 203, 323, 577, 1178, 1733
AsuC2I CCSGG 1 cut(s) 357
AsuHPI GGTGA 2 cut(s) 265, 345
AvaI CYCGRG 1 cut(s) 102
AvaII GGWCC 4 cut(s) 203, 577, 1178, 1733
BaeGI GKGCMC 1 cut(s) 1712
BanI GGYRCC 1 cut(s) 452
BanII GRGCYC 1 cut(s) 220
Bbv12I GWGCWC 1 cut(s) 220
BbvI GCAGC 3 cut(s) 49, 620, 1192
BccI CCATC 6 cut(s) 314, 812, 1411, 1435, 1590, 1613
BceAI ACGGC 1 cut(s) 802
BciT130I CCWGG 3 cut(s) 201, 834, 1629
BciVI GTATCC 2 cut(s) 223, 1098
BcnI CCSGG 1 cut(s) 357
BcoDI GTCTC 3 cut(s) 1524, 1654, 1712
BcuI ACTAGT 1 cut(s) 23
BfaI CTAG 5 cut(s) 24, 153, 435, 1352, 1394
BfmI CTRYAG 2 cut(s) 915, 1264
BfuI GTATCC 2 cut(s) 223, 1098
BisI GCNGC 3 cut(s) 63, 609, 1206
BlpI GCTNAGC 1 cut(s) 1072
BlsI GCNGC 3 cut(s) 64, 610, 1207
BmcAI AGTACT 2 cut(s) 19, 33
Bme1390I CCNGG 4 cut(s) 201, 357, 834, 1629
Bme18I GGWCC 4 cut(s) 203, 577, 1178, 1733
BmeT110I CYCGRG 1 cut(s) 102
BmgBI CACGTC 1 cut(s) 850
BmgT120I GGNCC 5 cut(s) 203, 323, 577, 1178, 1733
BmiI GGNNCC 5 cut(s) 454, 579, 790, 1180, 1450
BmrFI CCNGG 4 cut(s) 201, 357, 834, 1629
BmrI ACTGGG 1 cut(s) 1014
BmsI GCATC 2 cut(s) 937, 1030
BmuI ACTGGG 1 cut(s) 1014
BoxI GACNNNNGTC 2 cut(s) 570, 1382
BplI GAGNNNNNCTC 2 cut(s) 1517, 1549
BpmI CTGGAG 2 cut(s) 1152, 1722
Bpu10I CCTNAGC 1 cut(s) 498
Bpu1102I GCTNAGC 1 cut(s) 1072
BpuMI CCSGG 1 cut(s) 357
Bsa29I ATCGAT 1 cut(s) 729
BsaAI YACGTR 1 cut(s) 1567
BsaJI CCNNGG 3 cut(s) 311, 832, 1372
Bsc4I CCNNNNNNNGG 6 cut(s) 282, 476, 772, 1175, 1266, 1592
Bse118I RCCGGY 2 cut(s) 630, 1282
Bse1I ACTGG 4 cut(s) 29, 287, 434, 1020
Bse3DI GCAATG 1 cut(s) 750
BseBI CCWGG 3 cut(s) 201, 834, 1629
BseCI ATCGAT 1 cut(s) 729
BseDI CCNNGG 3 cut(s) 311, 832, 1372
BseGI GGATG 3 cut(s) 75, 1459, 1601
BseLI CCNNNNNNNGG 6 cut(s) 282, 476, 772, 1175, 1266, 1592
BseMI GCAATG 1 cut(s) 750
BseMII CTCAG 2 cut(s) 489, 1707
BseNI ACTGG 4 cut(s) 29, 287, 434, 1020
BseRI GAGGAG 1 cut(s) 527
BseSI GKGCMC 1 cut(s) 1712
BseXI GCAGC 3 cut(s) 49, 620, 1192
BshFI GGCC 2 cut(s) 324, 630
BshNI GGYRCC 1 cut(s) 452
BshVI ATCGAT 1 cut(s) 729
BsiHKAI GWGCWC 1 cut(s) 220
BsiHKCI CYCGRG 1 cut(s) 102
BsiSI CCGG 3 cut(s) 356, 631, 1283
BslFI GGGAC 3 cut(s) 1085, 1164, 1390
BslI CCNNNNNNNGG 6 cut(s) 282, 476, 772, 1175, 1266, 1592
BsmAI GTCTC 3 cut(s) 1524, 1654, 1712
BsmFI GGGAC 3 cut(s) 1085, 1164, 1390
BsmI GAATGC 1 cut(s) 1043
BsnI GGCC 2 cut(s) 324, 630
BsoBI CYCGRG 1 cut(s) 102
Bsp1286I GDGCHC 2 cut(s) 220, 1712
Bsp1407I TGTACA 1 cut(s) 1131
Bsp143I GATC 4 cut(s) 516, 530, 1354, 1555
Bsp1720I GCTNAGC 1 cut(s) 1072
Bsp19I CCATGG 1 cut(s) 311
BspACI CCGC 2 cut(s) 83, 1146
BspANI GGCC 2 cut(s) 324, 630
BspCNI CTCAG 2 cut(s) 490, 1708
BspDI ATCGAT 1 cut(s) 729
BspLI GGNNCC 5 cut(s) 454, 579, 790, 1180, 1450
BspPI GGATC 2 cut(s) 538, 1550
BspQI GCTCTTC 1 cut(s) 92
BspT107I GGYRCC 1 cut(s) 452
BsrBI CCGCTC 1 cut(s) 85
BsrDI GCAATG 1 cut(s) 750
BsrFI RCCGGY 2 cut(s) 630, 1282
BsrGI TGTACA 1 cut(s) 1131
BsrI ACTGG 4 cut(s) 29, 287, 434, 1020
BssAI RCCGGY 2 cut(s) 630, 1282
BssECI CCNNGG 3 cut(s) 311, 832, 1372
BssMI GATC 4 cut(s) 516, 530, 1354, 1555
BssT1I CCWWGG 2 cut(s) 311, 1372
Bst2UI CCWGG 3 cut(s) 201, 834, 1629
Bst4CI ACNGT 7 cut(s) 48, 452, 772, 919, 928, 1369, 1411
Bst6I CTCTTC 4 cut(s) 8, 92, 504, 892
BstAUI TGTACA 1 cut(s) 1131
BstBAI YACGTR 1 cut(s) 1567
BstC8I GCNNGC 7 cut(s) 220, 417, 442, 471, 632, 1210, 1280
BstDEI CTNAG 4 cut(s) 498, 1072, 1716, 1787
BstDSI CCRYGG 1 cut(s) 311
BstENI CCTNNNNNAGG 1 cut(s) 1264
BstF5I GGATG 3 cut(s) 75, 1459, 1601
BstKTI GATC 4 cut(s) 519, 533, 1357, 1558
BstMAI GTCTC 3 cut(s) 1524, 1654, 1712
BstMBI GATC 4 cut(s) 516, 530, 1354, 1555
BstMWI GCNNNNNNNGC 3 cut(s) 215, 786, 947
BstNI CCWGG 3 cut(s) 201, 834, 1629
BstNSI RCATGY 1 cut(s) 419
BstPAI GACNNNNGTC 2 cut(s) 570, 1382
BstSCI CCNGG 4 cut(s) 199, 355, 832, 1627
BstSFI CTRYAG 2 cut(s) 915, 1264
BstSLI GKGCMC 1 cut(s) 1712
BstSNI TACGTA 1 cut(s) 1567
BstV1I GCAGC 3 cut(s) 49, 620, 1192
BstX2I RGATCY 1 cut(s) 530
BstXI CCANNNNNNTGG 1 cut(s) 1635
BstYI RGATCY 1 cut(s) 530
Bsu15I ATCGAT 1 cut(s) 729
BsuI GTATCC 2 cut(s) 223, 1098
BsuRI GGCC 2 cut(s) 324, 630
BsuTUI ATCGAT 1 cut(s) 729
BtgI CCRYGG 1 cut(s) 311
BtgZI GCGATG 1 cut(s) 1358
BtrI CACGTC 1 cut(s) 850
BtsCI GGATG 3 cut(s) 75, 1459, 1601
BtsIMutI CAGTG 3 cut(s) 280, 768, 1332
Cac8I GCNNGC 7 cut(s) 220, 417, 442, 471, 632, 1210, 1280
CaiI CAGNNNCTG 2 cut(s) 52, 932
Cfr10I RCCGGY 2 cut(s) 630, 1282
Cfr13I GGNCC 5 cut(s) 203, 323, 577, 1178, 1733
ClaI ATCGAT 1 cut(s) 729
CseI GACGC 1 cut(s) 1201
Csp6I GTAC 4 cut(s) 18, 32, 1132, 1164
CviQI GTAC 4 cut(s) 18, 32, 1132, 1164
DdeI CTNAG 4 cut(s) 498, 1072, 1716, 1787
DpnI GATC 4 cut(s) 518, 532, 1356, 1557
DpnII GATC 4 cut(s) 516, 530, 1354, 1555
EaeI YGGCCR 1 cut(s) 628
Eam1104I CTCTTC 4 cut(s) 8, 92, 504, 892
EarI CTCTTC 4 cut(s) 8, 92, 504, 892
EciI GGCGGA 1 cut(s) 1135
Ecl136II GAGCTC 1 cut(s) 218
Eco105I TACGTA 1 cut(s) 1567
Eco130I CCWWGG 2 cut(s) 311, 1372
Eco24I GRGCYC 1 cut(s) 220
Eco47I GGWCC 4 cut(s) 203, 577, 1178, 1733
Eco53kI GAGCTC 1 cut(s) 218
Eco88I CYCGRG 1 cut(s) 102
EcoICRI GAGCTC 1 cut(s) 218
EcoNI CCTNNNNNAGG 1 cut(s) 1264
EcoO109I RGGNCCY 1 cut(s) 1178
EcoRII CCWGG 3 cut(s) 199, 832, 1627
EcoT14I CCWWGG 2 cut(s) 311, 1372
EcoT22I ATGCAT 1 cut(s) 1045
EcoT38I GRGCYC 1 cut(s) 220
ErhI CCWWGG 2 cut(s) 311, 1372
FaqI GGGAC 3 cut(s) 1085, 1164, 1390
FblI GTMKAC 1 cut(s) 41
Fnu4HI GCNGC 3 cut(s) 63, 609, 1206
FokI GGATG 3 cut(s) 62, 1446, 1608
FriOI GRGCYC 1 cut(s) 220
Fsp4HI GCNGC 3 cut(s) 63, 609, 1206
FspBI CTAG 5 cut(s) 24, 153, 435, 1352, 1394
GluI GCNGC 3 cut(s) 63, 609, 1206
GsuI CTGGAG 2 cut(s) 1152, 1722
HaeIII GGCC 2 cut(s) 324, 630
HapII CCGG 3 cut(s) 356, 631, 1283
HgaI GACGC 1 cut(s) 1201
HincII GTYRAC 6 cut(s) 42, 387, 565, 922, 1365, 1602
HindII GTYRAC 6 cut(s) 42, 387, 565, 922, 1365, 1602
HindIII AAGCTT 1 cut(s) 1069
HinfI GANTC 8 cut(s) 164, 935, 1244, 1456, 1532, 1682, 1772, 1810
HpaI GTTAAC 1 cut(s) 1602
HpaII CCGG 3 cut(s) 356, 631, 1283
HphI GGTGA 2 cut(s) 265, 345
Hpy188I TCNGA 7 cut(s) 530, 711, 896, 934, 991, 1239, 1610
Hpy188III TCNNGA 4 cut(s) 497, 575, 1169, 1304
Hpy99I CGWCG 1 cut(s) 678
HpyAV CCTTC 2 cut(s) 392, 1761
HpyCH4III ACNGT 7 cut(s) 48, 452, 772, 919, 928, 1369, 1411
HpyCH4IV ACGT 4 cut(s) 668, 849, 1566, 1574
HpyCH4V TGCA 6 cut(s) 584, 956, 1043, 1208, 1468, 1474
HpyF10VI GCNNNNNNNGC 3 cut(s) 215, 786, 947
HpyF3I CTNAG 4 cut(s) 498, 1072, 1716, 1787
HpySE526I ACGT 4 cut(s) 668, 849, 1566, 1574
KroI GCCGGC 1 cut(s) 630
KroNI GCCGGC 1 cut(s) 632
KspAI GTTAAC 1 cut(s) 1602
Kzo9I GATC 4 cut(s) 516, 530, 1354, 1555
LguI GCTCTTC 1 cut(s) 92
LmnI GCTCC 4 cut(s) 659, 794, 879, 1000
Lsp1109I GCAGC 3 cut(s) 49, 620, 1192
LweI GCATC 2 cut(s) 937, 1030
MaeI CTAG 5 cut(s) 24, 153, 435, 1352, 1394
MaeII ACGT 4 cut(s) 668, 849, 1566, 1574
MaeIII GTNAC 7 cut(s) 334, 425, 614, 974, 1567, 1649, 1790
MalI GATC 4 cut(s) 518, 532, 1356, 1557
MbiI CCGCTC 1 cut(s) 85
MboI GATC 4 cut(s) 516, 530, 1354, 1555
MboII GAAGA 8 cut(s) 25, 79, 407, 521, 695, 698, 909, 1711
MflI RGATCY 1 cut(s) 530
MhlI GDGCHC 2 cut(s) 220, 1712
MluCI AATT 8 cut(s) 234, 364, 547, 621, 865, 1014, 1546, 1799
MlyI GAGTC 3 cut(s) 929, 1526, 1691
MmeI TCCRAC 1 cut(s) 874
MnlI CCTC 6 cut(s) 133, 505, 776, 1192, 1569, 1746
Mph1103I ATGCAT 1 cut(s) 1045
MroNI GCCGGC 1 cut(s) 630
MseI TTAA 6 cut(s) 135, 243, 624, 1326, 1601, 1806
MslI CAYNNNNRTG 2 cut(s) 285, 1473
MspA1I CMGCKG 1 cut(s) 611
MspI CCGG 3 cut(s) 356, 631, 1283
MspR9I CCNGG 4 cut(s) 201, 357, 834, 1629
Mva1269I GAATGC 1 cut(s) 1043
MvaI CCWGG 3 cut(s) 201, 834, 1629
MwoI GCNNNNNNNGC 3 cut(s) 215, 786, 947
NaeI GCCGGC 1 cut(s) 632
NciI CCSGG 1 cut(s) 357
NcoI CCATGG 1 cut(s) 311
NdeII GATC 4 cut(s) 516, 530, 1354, 1555
NgoMIV GCCGGC 1 cut(s) 630
NlaIV GGNNCC 5 cut(s) 454, 579, 790, 1180, 1450
NmuCI GTSAC 4 cut(s) 334, 425, 1649, 1790
NsiI ATGCAT 1 cut(s) 1045
NspI RCATGY 1 cut(s) 419
PaeI GCATGC 1 cut(s) 419
PaeR7I CTCGAG 1 cut(s) 102
PciSI GCTCTTC 1 cut(s) 92
PcsI WCGNNNNNNNCGW 1 cut(s) 726
PctI GAATGC 1 cut(s) 1043
PdiI GCCGGC 1 cut(s) 632
PfeI GAWTC 5 cut(s) 164, 1244, 1456, 1772, 1810
PflMI CCANNNNNTGG 1 cut(s) 282
PkrI GCNGC 3 cut(s) 64, 610, 1207
PleI GAGTC 3 cut(s) 929, 1526, 1690
PpsI GAGTC 3 cut(s) 929, 1526, 1690
Ppu21I YACGTR 1 cut(s) 1567
PpuMI RGGWCCY 1 cut(s) 1178
PshAI GACNNNNGTC 2 cut(s) 570, 1382
PshBI ATTAAT 1 cut(s) 624
PsiI TTATAA 2 cut(s) 1545, 1580
Psp124BI GAGCTC 1 cut(s) 220
Psp1406I AACGTT 1 cut(s) 1574
Psp5II RGGWCCY 1 cut(s) 1178
Psp6I CCWGG 3 cut(s) 199, 832, 1627
PspGI CCWGG 3 cut(s) 199, 832, 1627
PspN4I GGNNCC 5 cut(s) 454, 579, 790, 1180, 1450
PspPI GGNCC 5 cut(s) 203, 323, 577, 1178, 1733
PspPPI RGGWCCY 1 cut(s) 1178
PspXI VCTCGAGB 1 cut(s) 102
PsrI GAACNNNNNNTAC 2 cut(s) 352, 384
PstNI CAGNNNCTG 2 cut(s) 52, 932
PsuI RGATCY 1 cut(s) 530
PvuII CAGCTG 1 cut(s) 611
RsaI GTAC 4 cut(s) 19, 33, 1133, 1165
RsaNI GTAC 4 cut(s) 18, 32, 1132, 1164
RseI CAYNNNNRTG 2 cut(s) 285, 1473
SacI GAGCTC 1 cut(s) 220
SalI GTCGAC 1 cut(s) 40
SapI GCTCTTC 1 cut(s) 92
SaqAI TTAA 6 cut(s) 135, 243, 624, 1326, 1601, 1806
SatI GCNGC 3 cut(s) 63, 609, 1206
Sau3AI GATC 4 cut(s) 516, 530, 1354, 1555
Sau96I GGNCC 5 cut(s) 203, 323, 577, 1178, 1733
ScaI AGTACT 2 cut(s) 19, 33
SchI GAGTC 3 cut(s) 929, 1526, 1691
ScrFI CCNGG 4 cut(s) 201, 357, 834, 1629
SduI GDGCHC 2 cut(s) 220, 1712
SfaNI GCATC 2 cut(s) 937, 1030
SfcI CTRYAG 2 cut(s) 915, 1264
Sfr274I CTCGAG 1 cut(s) 102
SinI GGWCC 4 cut(s) 203, 577, 1178, 1733
SlaI CTCGAG 1 cut(s) 102
SmiMI CAYNNNNRTG 2 cut(s) 285, 1473
SmlI CTYRAG 1 cut(s) 102
SmoI CTYRAG 1 cut(s) 102
SnaBI TACGTA 1 cut(s) 1567
SpeI ACTAGT 1 cut(s) 23
SphI GCATGC 1 cut(s) 419
Sse9I AATT 8 cut(s) 234, 364, 547, 621, 865, 1014, 1546, 1799
SsiI CCGC 2 cut(s) 83, 1146
SspI AATATT 1 cut(s) 1063
SspMI CTAG 5 cut(s) 24, 153, 435, 1352, 1394
SstI GAGCTC 1 cut(s) 220
StyD4I CCNGG 4 cut(s) 199, 355, 832, 1627
StyI CCWWGG 2 cut(s) 311, 1372
TaaI ACNGT 7 cut(s) 48, 452, 772, 919, 928, 1369, 1411
TaiI ACGT 4 cut(s) 671, 852, 1569, 1577
TaqI TCGA 4 cut(s) 41, 103, 729, 1357
TaqII GACCGA 1 cut(s) 1721
TasI AATT 8 cut(s) 234, 364, 547, 621, 865, 1014, 1546, 1799
TatI WGTACW 4 cut(s) 17, 31, 1131, 1163
TfiI GAWTC 5 cut(s) 164, 1244, 1456, 1772, 1810
Tru1I TTAA 6 cut(s) 135, 243, 624, 1326, 1601, 1806
Tru9I TTAA 6 cut(s) 135, 243, 624, 1326, 1601, 1806
TscAI CASTG 3 cut(s) 287, 775, 1339
TseFI GTSAC 4 cut(s) 334, 425, 1649, 1790
TseI GCWGC 3 cut(s) 62, 608, 1205
Tsp45I GTSAC 4 cut(s) 334, 425, 1649, 1790
TspDTI ATGAA 7 cut(s) 17, 26, 79, 104, 522, 1305, 1419
TspGWI ACGGA 3 cut(s) 1071, 1441, 1608
TspRI CASTG 3 cut(s) 287, 775, 1339
Van91I CCANNNNNTGG 1 cut(s) 282
VpaK11BI GGWCC 4 cut(s) 203, 577, 1178, 1733
VspI ATTAAT 1 cut(s) 624
XagI CCTNNNNNAGG 1 cut(s) 1264
XapI RAATTY 4 cut(s) 364, 547, 865, 1014
XceI RCATGY 1 cut(s) 419
XcmI CCANNNNNNNNNTGG 1 cut(s) 309
XhoI CTCGAG 1 cut(s) 102
XmiI GTMKAC 1 cut(s) 41
XspI CTAG 5 cut(s) 24, 153, 435, 1352, 1394
ZrmI AGTACT 2 cut(s) 19, 33
Zsp2I ATGCAT 1 cut(s) 1045
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.