Rmu_sc0004443.1_g000016

FAR1-related protein

Design Primers CRISPR Design

Basic Information

Type: gene
Biological Identity
rosa_multiflora
Rmu_sc0004443.1
OG0000414
Physical Location & Seq
Forward (+)
43113 .. 45135
2023 bp
Loading structure...
UTR
Exon/CDS
Intron
Rmu_sc0004443.1_g000016.1.cds

Sequence Viewer

Length: 1893 bp
atgattccatctcaacggaatctaatagatagtcaagctattcatattgattttgccgatgactctggacttaaaccaaaggctgcacaccaatttttcagtcaacaagttggtgggaaggaaaatcttggatacattgaaagggatcaaaaaaattacttaagaagtaagcggcaaaaggctatggcatatggagaagcaggcagcctcctaagatatttacacaatcaatcttgtgagaatccctcattccaatatgctgtacaattggatagtgaagaacatattacaaatatattttgggcagatacaagaatgattattgcttatgttcattttggtgatgtcattactttcgacaccacatacagtactaataaagaatataggccttttggagtattttctgggtttaatcatcacagagagactgtactatttagggctgcactcctttatgatgagacagctgaatcttttaagtggttgttccaaacattcttagaagcacataagcaaaaaaagccaaagactatatttacagaccaagatcctgcaatggcaaaggcattggtcgaggtgcttccagatacgtttcatggattatgtagttggcatataatgcaaaatggaatcaagcatttgggatacctgataaaggatggctcattttttcttacagattttgcagcatgcatgtatgagcacgaggaagagaaagaatttgaagatgcttggaatgctatgctatgcaaatataatgtttggagcaatccatggttggaaaagatatatgaaattaaggagaaatgggctaaatgttatatgaaaaaggtatttacaattggtatgcgaagtacacagcttagtgaaagcctgaacagtgatttaaaagcttacttaaagtcagacatggatatcatgcgtttttttaaacagtttgaaagggtcgctaatgaaaagcactataaggagctagaagctgagtataattctaggcaaaagttaccgagagtgaaggtacaaaaatcacctgtactacaacaagcagcgaaaatctacactccatcaatctttgaaaagtatttccaagaagaatttgattggtcttcagcagctattataaaacagcgtgaggaatctactcatacacatgagtatacgattgccattgtagatgaaaaaagagagcataaggagcataaggtgaaatttcaaacttcagaccaaagtatcttatgcagttgcatgaaatttcagagttttggaattttgtgttgtcatgctctgaaagttcttgatgtatgggatattaaaagaattcctgatcaagatattcttaagaggtggactagggaggcaagaaatgaggctgttgcaagcatgaatgaagccaatgtaatggaagataagaaattgactatagctgagcgatatagaacagcttgccctatattagttgatattgcatctcgagcatctggagatgaaaaggcctttgaattggtaatgaaaatcgcacatgagttaagaaaacaggttgaagacatcttcttggacaactcaacaacgagtattgatgaactgcataattcttcgcaaggtgggggtgagaggatggttcaagaaagtcaaattgaaagcttacttcagaaggcaaaaggtttgaagaagaaaaacaattgtaaaggtcgcaaaaaacgccctaaggcttggcatgagaatataggcaagggaaagaaaaaatcttctaggaaagataattcaattcaagaatcagataagggtcaagaagttgaaccatcgaaaaagaaaaatgagaaatcatctgataaagatcaatcagtaccacaacaatctcaggtaagaaaggttgttatcatgcacatgtga
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families
FAR1 MULE SWIM

Protein Analysis

630

Amino Acids

73.4

Weight (kDa)

8.56

Isoelectric Point (pI)

47.4

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready
iTOL Interactive Tree Of Life · Most popular EvolView Flexible annotations MEGA Desktop phylogenetics suite FigTree Desktop tree editor

Orthologous Genes (Group: OG0000414)

Species Orthologous Gene IDs
fragaria_vesca FvH4_1g15941 FvH4_1g22181 FvH4_3g31442 FvH4_4g06832 FvH4_5g15722 FvH4_6g30661 FvH4_7g13761
rosa_chinensis RchiOBHm_Chr3g0478271 RchiOBHm_Chr4g0421141
rosa_laevigata RLG00000002038 RLG00000016047 RLG00000021902 RLG00000024696 RLG00000027779 RLG00000033727 RLG00000035621
rosa_multiflora Rmu_sc0000125.1_g000007 Rmu_sc0000221.1_g000019 Rmu_sc0000221.1_g000020 Rmu_sc0000338.1_g000006 Rmu_sc0000429.1_g000059 Rmu_sc0000429.1_g000060 Rmu_sc0000429.1_g000061 Rmu_sc0000543.1_g000046 Rmu_sc0000689.1_g000008 Rmu_sc0000689.1_g000009 Rmu_sc0001436.1_g000002 Rmu_sc0001634.1_g000004 Rmu_sc0001782.1_g000025 Rmu_sc0002206.1_g000012 Rmu_sc0002985.1_g000008 Rmu_sc0002985.1_g000009 Rmu_sc0003044.1_g000040 Rmu_sc0003044.1_g000041 Rmu_sc0003044.1_g000042 Rmu_sc0003275.1_g000010 Rmu_sc0003561.1_g000002 Rmu_sc0003850.1_g000001 Rmu_sc0003850.1_g000002 Rmu_sc0004092.1_g000039 Rmu_sc0004311.1_g000003 Rmu_sc0004443.1_g000016 Rmu_sc0004542.1_g000002 Rmu_sc0004873.1_g000001 Rmu_sc0005757.1_g000002 Rmu_sc0005964.1_g000004 Rmu_sc0006598.1_g000014 Rmu_sc0006598.1_g000015 Rmu_sc0006889.1_g000023 Rmu_sc0007059.1_g000007 Rmu_sc0007390.1_g000014 Rmu_sc0008085.1_g000015 Rmu_sc0009948.1_g000001 Rmu_sc0010235.1_g000005 Rmu_sc0010665.1_g000022 Rmu_sc0011183.1_g000001 Rmu_sc0021637.1_g000001 Rmu_ssc0000242.1_g000016 Rmu_ssc0000317.1_g000003 Rmu_ssc0000317.1_g000004 Rmu_ssc0000432.1_g000093 Rmu_ssc0000432.1_g000095
rosa_roxburghii Rroxscaffold_1G00024670 Rroxscaffold_1G00047120 Rroxscaffold_4G00283230 Rroxscaffold_5G00365300 Rroxscaffold_7G00192220
rosa_rugosa Rorug03G0325200 Rorug06G0093800 Rorug07G0209800
rosa_samantha Rh1AG084000 Rh1AG202300 Rh1AG294200 Rh1BG259000 Rh2AG357500 Rh2AG389500 Rh2CG376700 Rh2CG468700 Rh2DG441200 Rh2DG504700 Rh2DG505700 Rh3BG359700 Rh3DG120200 Rh4BG161300 Rh4CG087000 Rh5BG550100 Rh5CG573000 Rh6AG284900 Rh6AG426700 Rh7DG285400
rosa_wichuraiana Rw1G030090 Rw2G030600 Rw3G018220 Rw3G027930 Rw4G000900 Rw6G003680 Rw6G036920 Rw6G043190 Rw7G020880

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AanI TTATAA 1 cut(s) 1124
AccI GTMKAC 1 cut(s) 1160
AciI CCGC 1 cut(s) 172
AclWI GGATC 2 cut(s) 153, 545
AcsI RAATTY 6 cut(s) 722, 1097, 1211, 1253, 1269, 1320
AcuI CTGAAG 3 cut(s) 1095, 1206, 1634
AfaI GTAC 7 cut(s) 264, 373, 435, 859, 1023, 1038, 1848
AfiI CCNNNNNNNGG 1 cut(s) 658
AflII CTTAAG 2 cut(s) 160, 1340
AflIII ACRYGT 1 cut(s) 1887
Alw21I GWGCWC 1 cut(s) 708
Alw26I GTCTC 2 cut(s) 422, 458
AlwI GGATC 2 cut(s) 153, 545
Ama87I CYCGRG 1 cut(s) 1473
AoxI GGCC 2 cut(s) 389, 1494
ApeKI GCWGC 6 cut(s) 83, 204, 446, 689, 1049, 1115
ApoI RAATTY 6 cut(s) 722, 1097, 1211, 1253, 1269, 1320
AsuHPI GGTGA 4 cut(s) 353, 1023, 1219, 1622
AvaI CYCGRG 1 cut(s) 1473
AxyI CCTNAGG 1 cut(s) 1707
BaeI ACNNNNGTAYC 2 cut(s) 1216, 1249
BauI CACGAG 1 cut(s) 707
BbsI GAAGAC 2 cut(s) 1101, 1551
Bbv12I GWGCWC 1 cut(s) 708
BbvI GCAGC 6 cut(s) 70, 216, 433, 701, 1061, 1127
BccI CCATC 5 cut(s) 16, 656, 1075, 1612, 1810
BciVI GTATCC 2 cut(s) 125, 641
BclI TGATCA 1 cut(s) 1327
BcoDI GTCTC 2 cut(s) 422, 458
BfaI CTAG 4 cut(s) 977, 996, 1353, 1752
BfmI CTRYAG 1 cut(s) 1422
BfrI CTTAAG 2 cut(s) 160, 1340
BfuI GTATCC 2 cut(s) 125, 641
BisI GCNGC 7 cut(s) 84, 173, 205, 447, 690, 1050, 1116
BlpI GCTNAGC 1 cut(s) 1428
BlsI GCNGC 7 cut(s) 85, 174, 206, 448, 691, 1051, 1117
BmcAI AGTACT 1 cut(s) 373
BmeT110I CYCGRG 1 cut(s) 1473
BmsI GCATC 3 cut(s) 721, 1478, 1487
BpiI GAAGAC 2 cut(s) 1101, 1551
BplI GAGNNNNNCTC 2 cut(s) 230, 262
BpmI CTGGAG 1 cut(s) 1503
Bpu1102I GCTNAGC 1 cut(s) 1428
BsaBI GATNNNNATC 1 cut(s) 1836
BsaJI CCNNGG 1 cut(s) 776
Bsc4I CCNNNNNNNGG 1 cut(s) 658
Bse21I CCTNAGG 1 cut(s) 1707
Bse3DI GCAATG 1 cut(s) 564
Bse8I GATNNNNATC 1 cut(s) 1836
BseDI CCNNGG 1 cut(s) 776
BseGI GGATG 2 cut(s) 667, 1623
BseJI GATNNNNATC 1 cut(s) 1836
BseLI CCNNNNNNNGG 1 cut(s) 658
BseMI GCAATG 1 cut(s) 564
BseMII CTCAG 3 cut(s) 975, 1419, 1874
BseXI GCAGC 6 cut(s) 70, 216, 433, 701, 1061, 1127
BsgI GTGCAG 2 cut(s) 69, 432
BshFI GGCC 2 cut(s) 391, 1496
BsiHKAI GWGCWC 1 cut(s) 708
BsiHKCI CYCGRG 1 cut(s) 1473
BslI CCNNNNNNNGG 1 cut(s) 658
BsmAI GTCTC 2 cut(s) 422, 458
BsmI GAATGC 1 cut(s) 745
BsnI GGCC 2 cut(s) 391, 1496
BsoBI CYCGRG 1 cut(s) 1473
Bsp1286I GDGCHC 1 cut(s) 708
Bsp1407I TGTACA 1 cut(s) 262
Bsp143I GATC 4 cut(s) 145, 550, 1327, 1837
Bsp1720I GCTNAGC 1 cut(s) 1428
Bsp19I CCATGG 1 cut(s) 776
BspACI CCGC 1 cut(s) 172
BspANI GGCC 2 cut(s) 391, 1496
BspCNI CTCAG 3 cut(s) 976, 1420, 1873
BspPI GGATC 2 cut(s) 153, 545
BspTI CTTAAG 2 cut(s) 160, 1340
BsrDI GCAATG 1 cut(s) 564
BsrGI TGTACA 1 cut(s) 262
BssECI CCNNGG 1 cut(s) 776
BssMI GATC 4 cut(s) 145, 550, 1327, 1837
BssNAI GTATAC 1 cut(s) 1161
BssSI CACGAG 1 cut(s) 707
BssT1I CCWWGG 1 cut(s) 776
Bst1107I GTATAC 1 cut(s) 1161
Bst2BI CACGAG 1 cut(s) 707
Bst4CI ACNGT 4 cut(s) 371, 433, 884, 939
Bst6I CTCTTC 1 cut(s) 708
BstAFI CTTAAG 2 cut(s) 160, 1340
BstAPI GCANNNNNTGC 1 cut(s) 622
BstAUI TGTACA 1 cut(s) 262
BstC8I GCNNGC 4 cut(s) 202, 694, 1381, 1447
BstDEI CTNAG 7 cut(s) 212, 502, 866, 984, 1428, 1707, 1860
BstDSI CCRYGG 1 cut(s) 776
BstENI CCTNNNNNAGG 1 cut(s) 656
BstF5I GGATG 2 cut(s) 667, 1623
BstKTI GATC 4 cut(s) 148, 553, 1330, 1840
BstMAI GTCTC 2 cut(s) 422, 458
BstMBI GATC 4 cut(s) 145, 550, 1327, 1837
BstMWI GCNNNNNNNGC 6 cut(s) 523, 622, 740, 1198, 1475, 1701
BstNSI RCATGY 3 cut(s) 696, 700, 1891
BstSFI CTRYAG 1 cut(s) 1422
BstV1I GCAGC 6 cut(s) 70, 216, 433, 701, 1061, 1127
BstV2I GAAGAC 2 cut(s) 1101, 1551
BstX2I RGATCY 1 cut(s) 550
BstXI CCANNNNNNTGG 1 cut(s) 1402
BstYI RGATCY 1 cut(s) 550
BstZ17I GTATAC 1 cut(s) 1161
Bsu36I CCTNAGG 1 cut(s) 1707
BsuI GTATCC 2 cut(s) 125, 641
BsuRI GGCC 2 cut(s) 391, 1496
BtgI CCRYGG 1 cut(s) 776
BtsCI GGATG 2 cut(s) 667, 1623
BtsIMutI CAGTG 1 cut(s) 889
Cac8I GCNNGC 4 cut(s) 202, 694, 1381, 1447
Csp6I GTAC 7 cut(s) 263, 372, 434, 858, 1022, 1037, 1847
CviQI GTAC 7 cut(s) 263, 372, 434, 858, 1022, 1037, 1847
DdeI CTNAG 7 cut(s) 212, 502, 866, 984, 1428, 1707, 1860
DpnI GATC 4 cut(s) 147, 552, 1329, 1839
DpnII GATC 4 cut(s) 145, 550, 1327, 1837
DraI TTTAAA 2 cut(s) 891, 934
Eam1104I CTCTTC 1 cut(s) 708
EarI CTCTTC 1 cut(s) 708
Eco130I CCWWGG 1 cut(s) 776
Eco147I AGGCCT 2 cut(s) 391, 1496
Eco32I GATATC 1 cut(s) 919
Eco57I CTGAAG 3 cut(s) 1095, 1206, 1634
Eco81I CCTNAGG 1 cut(s) 1707
Eco88I CYCGRG 1 cut(s) 1473
EcoNI CCTNNNNNAGG 1 cut(s) 656
EcoRI GAATTC 1 cut(s) 1320
EcoRV GATATC 1 cut(s) 919
EcoT14I CCWWGG 1 cut(s) 776
EcoT22I ATGCAT 1 cut(s) 698
ErhI CCWWGG 1 cut(s) 776
FalI AAGNNNNNCTT 2 cut(s) 1323, 1355
FauNDI CATATG 1 cut(s) 190
FbaI TGATCA 1 cut(s) 1327
FblI GTMKAC 1 cut(s) 1160
Fnu4HI GCNGC 7 cut(s) 84, 173, 205, 447, 690, 1050, 1116
FokI GGATG 2 cut(s) 674, 1630
Fsp4HI GCNGC 7 cut(s) 84, 173, 205, 447, 690, 1050, 1116
FspBI CTAG 4 cut(s) 977, 996, 1353, 1752
GluI GCNGC 7 cut(s) 84, 173, 205, 447, 690, 1050, 1116
GsuI CTGGAG 1 cut(s) 1503
HaeIII GGCC 2 cut(s) 391, 1496
HincII GTYRAC 1 cut(s) 104
HindII GTYRAC 1 cut(s) 104
HindIII AAGCTT 2 cut(s) 894, 1642
HinfI GANTC 8 cut(s) 4, 19, 62, 241, 473, 633, 1139, 1775
HphI GGTGA 4 cut(s) 353, 1023, 1219, 1622
Hpy166II GTNNAC 4 cut(s) 104, 860, 1161, 1350
Hpy188I TCNGA 7 cut(s) 910, 1225, 1260, 1290, 1653, 1780, 1831
Hpy8I GTNNAC 4 cut(s) 104, 860, 1161, 1350
HpyAV CCTTC 3 cut(s) 112, 1012, 1648
HpyCH4III ACNGT 4 cut(s) 371, 433, 884, 939
HpyCH4IV ACGT 1 cut(s) 593
HpyF10VI GCNNNNNNNGC 6 cut(s) 523, 622, 740, 1198, 1475, 1701
HpyF3I CTNAG 7 cut(s) 212, 502, 866, 984, 1428, 1707, 1860
HpySE526I ACGT 1 cut(s) 593
Ksp22I TGATCA 1 cut(s) 1327
Kzo9I GATC 4 cut(s) 145, 550, 1327, 1837
LmnI GCTCC 3 cut(s) 768, 973, 1198
Lsp1109I GCAGC 6 cut(s) 70, 216, 433, 701, 1061, 1127
LweI GCATC 3 cut(s) 721, 1478, 1487
MaeI CTAG 4 cut(s) 977, 996, 1353, 1752
MaeII ACGT 1 cut(s) 593
MaeIII GTNAC 1 cut(s) 1005
MalI GATC 4 cut(s) 147, 552, 1329, 1839
MboI GATC 4 cut(s) 145, 550, 1327, 1837
MfeI CAATTG 3 cut(s) 266, 843, 1681
MflI RGATCY 1 cut(s) 550
MhlI GDGCHC 1 cut(s) 708
MlyI GAGTC 1 cut(s) 56
MmeI TCCRAC 1 cut(s) 762
MnlI CCTC 9 cut(s) 218, 256, 571, 703, 1129, 1338, 1351, 1363, 1608
Mph1103I ATGCAT 1 cut(s) 698
MslI CAYNNNNRTG 3 cut(s) 339, 1152, 1886
MspA1I CMGCKG 1 cut(s) 470
MspCI CTTAAG 2 cut(s) 160, 1340
MunI CAATTG 3 cut(s) 266, 843, 1681
Mva1269I GAATGC 1 cut(s) 745
MwoI GCNNNNNNNGC 6 cut(s) 523, 622, 740, 1198, 1475, 1701
NcoI CCATGG 1 cut(s) 776
NdeI CATATG 1 cut(s) 190
NdeII GATC 4 cut(s) 145, 550, 1327, 1837
NsiI ATGCAT 1 cut(s) 698
NspI RCATGY 3 cut(s) 696, 700, 1891
PaeI GCATGC 1 cut(s) 696
PaeR7I CTCGAG 1 cut(s) 1473
PceI AGGCCT 2 cut(s) 391, 1496
PciI ACATGT 1 cut(s) 1887
PctI GAATGC 1 cut(s) 745
PfeI GAWTC 7 cut(s) 4, 19, 241, 473, 633, 1139, 1775
PkrI GCNGC 7 cut(s) 85, 174, 206, 448, 691, 1051, 1117
PleI GAGTC 1 cut(s) 56
PpsI GAGTC 1 cut(s) 56
PscI ACATGT 1 cut(s) 1887
PsiI TTATAA 1 cut(s) 1124
PsuI RGATCY 1 cut(s) 550
PvuII CAGCTG 1 cut(s) 470
RsaI GTAC 7 cut(s) 264, 373, 435, 859, 1023, 1038, 1848
RsaNI GTAC 7 cut(s) 263, 372, 434, 858, 1022, 1037, 1847
RseI CAYNNNNRTG 3 cut(s) 339, 1152, 1886
SatI GCNGC 7 cut(s) 84, 173, 205, 447, 690, 1050, 1116
Sau3AI GATC 4 cut(s) 145, 550, 1327, 1837
ScaI AGTACT 1 cut(s) 373
SchI GAGTC 1 cut(s) 56
SduI GDGCHC 1 cut(s) 708
SfaNI GCATC 3 cut(s) 721, 1478, 1487
SfcI CTRYAG 1 cut(s) 1422
Sfr274I CTCGAG 1 cut(s) 1473
SlaI CTCGAG 1 cut(s) 1473
SmiMI CAYNNNNRTG 3 cut(s) 339, 1152, 1886
SmlI CTYRAG 3 cut(s) 160, 1340, 1473
SmoI CTYRAG 3 cut(s) 160, 1340, 1473
SphI GCATGC 1 cut(s) 696
SseBI AGGCCT 2 cut(s) 391, 1496
SsiI CCGC 1 cut(s) 172
SspMI CTAG 4 cut(s) 977, 996, 1353, 1752
StuI AGGCCT 2 cut(s) 391, 1496
StyI CCWWGG 1 cut(s) 776
TaaI ACNGT 4 cut(s) 371, 433, 884, 939
TaiI ACGT 1 cut(s) 596
TaqI TCGA 4 cut(s) 357, 576, 1474, 1805
TatI WGTACW 5 cut(s) 262, 371, 433, 857, 1036
TauI GCSGC 1 cut(s) 175
TfiI GAWTC 7 cut(s) 4, 19, 241, 473, 633, 1139, 1775
TscAI CASTG 1 cut(s) 889
TseI GCWGC 6 cut(s) 83, 204, 446, 689, 1049, 1115
TspGWI ACGGA 1 cut(s) 31
TspRI CASTG 1 cut(s) 889
Vha464I CTTAAG 2 cut(s) 160, 1340
XagI CCTNNNNNAGG 1 cut(s) 656
XapI RAATTY 6 cut(s) 722, 1097, 1211, 1253, 1269, 1320
XceI RCATGY 3 cut(s) 696, 700, 1891
XhoI CTCGAG 1 cut(s) 1473
XmiI GTMKAC 1 cut(s) 1160
XspI CTAG 4 cut(s) 977, 996, 1353, 1752
ZrmI AGTACT 1 cut(s) 373
Zsp2I ATGCAT 1 cut(s) 698
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.