Rmu_sc0009948.1_g000001

FAR1-related protein

Design Primers CRISPR Design

Basic Information

Type: gene
Biological Identity
rosa_multiflora
Rmu_sc0009948.1
OG0000414
Physical Location & Seq
Forward (+)
3814 .. 5109
1296 bp
Loading structure...
UTR
Exon/CDS
Intron
Rmu_sc0009948.1_g000001.1.cds

Sequence Viewer

Length: 1296 bp
atgcaagcaggtggaagagatgatgttgggtatacaaaacaggatgtaaaaaactaccttcgatcaaggagacagagaagcttggagtatggagaagttggatatattatgaaatatttttcagatcaaacattggaaaacccttcattctaccatgctatgcaattagatagtgatgagcaaataacaaacttattttgggcagatgctaaaatgatcattgattatggccaatttggggatgttgttagcgattctagaattggtgtgacttctctatatgaattgatgggtatgcaagcaggtggaagagatgctgttgggtatacaaaacaggatgtaaaaaactaccttcgatcaaggagacagagaagcttggagtatggagaagctggatatattatgaaatatttttcagatcaaacattggaaaacccttcattctaccatgctatgcaattagatagtgaggagcaaataacaaacttattttgggcagatgctaaaatgatcattgattatggccaatttggggatgttattagttttgatacaacatacaaggttaacaaatctaatcgacctcttgctgtgtttgtcggattcaattatcaccttgagattattatatttggggtggctctaatgtatgatgaaacaaccgattcatttatatggttgtttgagacatttttgagggcaatggaatttggggatgttgttagttttgatacaacatacaaggttaacaaatctaatcgacctcttgctgtgtttgtcggattcaattatcaccgtgagactattatatttggggtggctctaatgtatgatgaaacaaccgattcatttatatggttgtttgagacatttttgagggcaatgtctggaaaggctccaaagacaatatttacagatcaagatgatacaatggcaaaggctcttcgacatgttatgcctgatgcatatcataggctttgcaaatggcatatgatgcaaaatgccatcaagcatggacatagttttttgacagaagaaggtgggatcacaagtgttttgtcaaggttcatggaaaatattgaggaggaagatgagtttatatctgcttgggatgctatgcttgataaatatggtgctcgtgacaaggtgactattgatccactatgtgatgaagagaatattgctgctgatctaacaagtaatgcagaccaatttctggaacaagatatatctgcatcttcacttagatttcttgcttgtagtcaggtatatcaatatttatttagttggtcttaa
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families
FAR1 MULE SWIM

Protein Analysis

431

Amino Acids

49.88

Weight (kDa)

4.74

Isoelectric Point (pI)

43.66

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready
iTOL Interactive Tree Of Life · Most popular EvolView Flexible annotations MEGA Desktop phylogenetics suite FigTree Desktop tree editor

Orthologous Genes (Group: OG0000414)

Species Orthologous Gene IDs
fragaria_vesca FvH4_1g15941 FvH4_1g22181 FvH4_3g31442 FvH4_4g06832 FvH4_5g15722 FvH4_6g30661 FvH4_7g13761
rosa_chinensis RchiOBHm_Chr3g0478271 RchiOBHm_Chr4g0421141
rosa_laevigata RLG00000002038 RLG00000016047 RLG00000021902 RLG00000024696 RLG00000027779 RLG00000033727 RLG00000035621
rosa_multiflora Rmu_sc0000125.1_g000007 Rmu_sc0000221.1_g000019 Rmu_sc0000221.1_g000020 Rmu_sc0000338.1_g000006 Rmu_sc0000429.1_g000059 Rmu_sc0000429.1_g000060 Rmu_sc0000429.1_g000061 Rmu_sc0000543.1_g000046 Rmu_sc0000689.1_g000008 Rmu_sc0000689.1_g000009 Rmu_sc0001436.1_g000002 Rmu_sc0001634.1_g000004 Rmu_sc0001782.1_g000025 Rmu_sc0002206.1_g000012 Rmu_sc0002985.1_g000008 Rmu_sc0002985.1_g000009 Rmu_sc0003044.1_g000040 Rmu_sc0003044.1_g000041 Rmu_sc0003044.1_g000042 Rmu_sc0003275.1_g000010 Rmu_sc0003561.1_g000002 Rmu_sc0003850.1_g000001 Rmu_sc0003850.1_g000002 Rmu_sc0004092.1_g000039 Rmu_sc0004311.1_g000003 Rmu_sc0004443.1_g000016 Rmu_sc0004542.1_g000002 Rmu_sc0004873.1_g000001 Rmu_sc0005757.1_g000002 Rmu_sc0005964.1_g000004 Rmu_sc0006598.1_g000014 Rmu_sc0006598.1_g000015 Rmu_sc0006889.1_g000023 Rmu_sc0007059.1_g000007 Rmu_sc0007390.1_g000014 Rmu_sc0008085.1_g000015 Rmu_sc0009948.1_g000001 Rmu_sc0010235.1_g000005 Rmu_sc0010665.1_g000022 Rmu_sc0011183.1_g000001 Rmu_sc0021637.1_g000001 Rmu_ssc0000242.1_g000016 Rmu_ssc0000317.1_g000003 Rmu_ssc0000317.1_g000004 Rmu_ssc0000432.1_g000093 Rmu_ssc0000432.1_g000095
rosa_roxburghii Rroxscaffold_1G00024670 Rroxscaffold_1G00047120 Rroxscaffold_4G00283230 Rroxscaffold_5G00365300 Rroxscaffold_7G00192220
rosa_rugosa Rorug03G0325200 Rorug06G0093800 Rorug07G0209800
rosa_samantha Rh1AG084000 Rh1AG202300 Rh1AG294200 Rh1BG259000 Rh2AG357500 Rh2AG389500 Rh2CG376700 Rh2CG468700 Rh2DG441200 Rh2DG504700 Rh2DG505700 Rh3BG359700 Rh3DG120200 Rh4BG161300 Rh4CG087000 Rh5BG550100 Rh5CG573000 Rh6AG284900 Rh6AG426700 Rh7DG285400
rosa_wichuraiana Rw1G030090 Rw2G030600 Rw3G018220 Rw3G027930 Rw4G000900 Rw6G003680 Rw6G036920 Rw6G043190 Rw7G020880

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AarI CACCTGC 1 cut(s) 293
Acc36I ACCTGC 1 cut(s) 293
AccB7I CCANNNNNTGG 1 cut(s) 1216
AccI GTMKAC 2 cut(s) 32, 326
AclWI GGATC 2 cut(s) 1052, 1151
AcoI YGGCCR 2 cut(s) 229, 523
AcsI RAATTY 1 cut(s) 707
AdeI CACNNNGTG 1 cut(s) 1166
AfiI CCNNNNNNNGG 3 cut(s) 238, 532, 1216
AflIII ACRYGT 1 cut(s) 949
AgsI TTSAA 2 cut(s) 607, 787
AluBI AGCT 3 cut(s) 81, 375, 392
AluI AGCT 3 cut(s) 81, 375, 392
Alw21I GWGCWC 1 cut(s) 1138
Alw26I GTCTC 5 cut(s) 64, 358, 680, 794, 860
AlwI GGATC 2 cut(s) 1052, 1151
AoxI GGCC 2 cut(s) 229, 523
ApeKI GCWGC 1 cut(s) 1184
ApoI RAATTY 1 cut(s) 707
AsuHPI GGTGA 3 cut(s) 605, 785, 1159
BalI TGGCCA 2 cut(s) 231, 525
BauI CACGAG 1 cut(s) 1137
Bbv12I GWGCWC 1 cut(s) 1138
BbvI GCAGC 1 cut(s) 1171
BccI CCATC 2 cut(s) 283, 1013
BclI TGATCA 2 cut(s) 216, 510
BcoDI GTCTC 5 cut(s) 64, 358, 680, 794, 860
BfaI CTAG 1 cut(s) 258
BfuAI ACCTGC 1 cut(s) 293
BisI GCNGC 1 cut(s) 1185
BlsI GCNGC 1 cut(s) 1186
BmiI GGNNCC 1 cut(s) 897
BmsI GCATC 7 cut(s) 196, 304, 490, 952, 984, 1102, 1244
BpuEI CTTGAG 1 cut(s) 638
BsaBI GATNNNNATC 1 cut(s) 966
Bsc4I CCNNNNNNNGG 3 cut(s) 238, 532, 1216
Bse3DI GCAATG 2 cut(s) 708, 888
Bse8I GATNNNNATC 1 cut(s) 966
BseGI GGATG 6 cut(s) 49, 247, 343, 541, 721, 1117
BseJI GATNNNNATC 1 cut(s) 966
BseLI CCNNNNNNNGG 3 cut(s) 238, 532, 1216
BseMI GCAATG 2 cut(s) 708, 888
BseRI GAGGAG 2 cut(s) 485, 1097
BseXI GCAGC 1 cut(s) 1171
BshFI GGCC 2 cut(s) 231, 525
BsiHKAI GWGCWC 1 cut(s) 1138
BslI CCNNNNNNNGG 3 cut(s) 238, 532, 1216
BsmAI GTCTC 5 cut(s) 64, 358, 680, 794, 860
BsnI GGCC 2 cut(s) 231, 525
Bsp1286I GDGCHC 1 cut(s) 1138
BspANI GGCC 2 cut(s) 231, 525
BspLI GGNNCC 1 cut(s) 897
BspMI ACCTGC 1 cut(s) 293
BspPI GGATC 2 cut(s) 1052, 1151
BspQI GCTCTTC 1 cut(s) 948
BsrDI GCAATG 2 cut(s) 708, 888
BssNAI GTATAC 2 cut(s) 33, 327
BssSI CACGAG 1 cut(s) 1137
Bst1107I GTATAC 2 cut(s) 33, 327
Bst2BI CACGAG 1 cut(s) 1137
Bst4CI ACNGT 1 cut(s) 797
Bst6I CTCTTC 4 cut(s) 10, 304, 948, 1167
BstAPI GCANNNNNTGC 1 cut(s) 994
BstC8I GCNNGC 2 cut(s) 6, 300
BstDEI CTNAG 1 cut(s) 1244
BstF5I GGATG 6 cut(s) 49, 247, 343, 541, 721, 1117
BstMAI GTCTC 5 cut(s) 64, 358, 680, 794, 860
BstMWI GCNNNNNNNGC 2 cut(s) 994, 1112
BstNSI RCATGY 1 cut(s) 953
BstV1I GCAGC 1 cut(s) 1171
BstZ17I GTATAC 2 cut(s) 33, 327
BsuRI GGCC 2 cut(s) 231, 525
BtsCI GGATG 6 cut(s) 49, 247, 343, 541, 721, 1117
BveI ACCTGC 1 cut(s) 293
Cac8I GCNNGC 2 cut(s) 6, 300
CviAII CATG 5 cut(s) 155, 449, 950, 1013, 1069
DdeI CTNAG 1 cut(s) 1244
DraIII CACNNNGTG 1 cut(s) 1166
EaeI YGGCCR 2 cut(s) 229, 523
Eam1104I CTCTTC 4 cut(s) 10, 304, 948, 1167
EarI CTCTTC 4 cut(s) 10, 304, 948, 1167
EcoT22I ATGCAT 1 cut(s) 967
FaeI CATG 5 cut(s) 158, 452, 953, 1016, 1072
FatI CATG 5 cut(s) 154, 448, 949, 1012, 1068
FauNDI CATATG 1 cut(s) 990
FbaI TGATCA 2 cut(s) 216, 510
FblI GTMKAC 2 cut(s) 32, 326
Fnu4HI GCNGC 1 cut(s) 1185
FokI GGATG 6 cut(s) 56, 254, 350, 548, 728, 1124
Fsp4HI GCNGC 1 cut(s) 1185
FspBI CTAG 1 cut(s) 258
GluI GCNGC 1 cut(s) 1185
HaeIII GGCC 2 cut(s) 231, 525
Hin1II CATG 5 cut(s) 158, 452, 953, 1016, 1072
HincII GTYRAC 2 cut(s) 568, 748
HindII GTYRAC 2 cut(s) 568, 748
HindIII AAGCTT 2 cut(s) 79, 373
HinfI GANTC 5 cut(s) 254, 603, 665, 783, 845
HpaI GTTAAC 2 cut(s) 568, 748
HphI GGTGA 3 cut(s) 605, 785, 1159
Hpy166II GTNNAC 4 cut(s) 33, 327, 568, 748
Hpy188I TCNGA 4 cut(s) 124, 418, 602, 782
Hpy188III TCNNGA 5 cut(s) 258, 888, 920, 1139, 1217
Hpy8I GTNNAC 4 cut(s) 33, 327, 568, 748
HpyAV CCTTC 5 cut(s) 68, 153, 362, 447, 1031
HpyCH4III ACNGT 1 cut(s) 797
HpyCH4V TGCA 9 cut(s) 4, 163, 298, 457, 965, 981, 997, 1205, 1235
HpyF10VI GCNNNNNNNGC 2 cut(s) 994, 1112
HpyF3I CTNAG 1 cut(s) 1244
Hsp92II CATG 5 cut(s) 158, 452, 953, 1016, 1072
Ksp22I TGATCA 2 cut(s) 216, 510
KspAI GTTAAC 2 cut(s) 568, 748
LguI GCTCTTC 1 cut(s) 948
LmnI GCTCC 2 cut(s) 472, 901
LpnPI CCDG 8 cut(s) 26, 288, 320, 378, 873, 972, 1202, 1250
Lsp1109I GCAGC 1 cut(s) 1171
LweI GCATC 7 cut(s) 196, 304, 490, 952, 984, 1102, 1244
MaeI CTAG 1 cut(s) 258
MaeIII GTNAC 3 cut(s) 268, 1139, 1147
MboII GAAGA 7 cut(s) 27, 321, 935, 1046, 1100, 1184, 1230
MhlI GDGCHC 1 cut(s) 1138
MlsI TGGCCA 2 cut(s) 231, 525
MluNI TGGCCA 2 cut(s) 231, 525
MmeI TCCRAC 3 cut(s) 79, 580, 760
MnlI CCTC 7 cut(s) 463, 594, 690, 774, 870, 1075, 1078
Mox20I TGGCCA 2 cut(s) 231, 525
Mph1103I ATGCAT 1 cut(s) 967
MscI TGGCCA 2 cut(s) 231, 525
MseI TTAA 3 cut(s) 567, 747, 1294
MslI CAYNNNNRTG 2 cut(s) 673, 853
Msp20I TGGCCA 2 cut(s) 231, 525
MwoI GCNNNNNNNGC 2 cut(s) 994, 1112
NdeI CATATG 1 cut(s) 990
NlaIII CATG 5 cut(s) 158, 452, 953, 1016, 1072
NlaIV GGNNCC 1 cut(s) 897
NmuCI GTSAC 3 cut(s) 268, 1139, 1147
NsiI ATGCAT 1 cut(s) 967
NspI RCATGY 1 cut(s) 953
PaqCI CACCTGC 1 cut(s) 293
PciI ACATGT 1 cut(s) 949
PciSI GCTCTTC 1 cut(s) 948
PfeI GAWTC 5 cut(s) 254, 603, 665, 783, 845
PflMI CCANNNNNTGG 1 cut(s) 1216
PkrI GCNGC 1 cut(s) 1186
PscI ACATGT 1 cut(s) 949
PspN4I GGNNCC 1 cut(s) 897
RseI CAYNNNNRTG 2 cut(s) 673, 853
SapI GCTCTTC 1 cut(s) 948
SaqAI TTAA 3 cut(s) 567, 747, 1294
SatI GCNGC 1 cut(s) 1185
SduI GDGCHC 1 cut(s) 1138
SfaNI GCATC 7 cut(s) 196, 304, 490, 952, 984, 1102, 1244
SmiMI CAYNNNNRTG 2 cut(s) 673, 853
SmlI CTYRAG 1 cut(s) 617
SmoI CTYRAG 1 cut(s) 617
SspI AATATT 6 cut(s) 116, 410, 909, 1078, 1180, 1277
SspMI CTAG 1 cut(s) 258
TaaI ACNGT 1 cut(s) 797
TaqI TCGA 5 cut(s) 61, 355, 580, 760, 946
TfiI GAWTC 5 cut(s) 254, 603, 665, 783, 845
Tru1I TTAA 3 cut(s) 567, 747, 1294
Tru9I TTAA 3 cut(s) 567, 747, 1294
TseFI GTSAC 3 cut(s) 268, 1139, 1147
TseI GCWGC 1 cut(s) 1184
Tsp45I GTSAC 3 cut(s) 268, 1139, 1147
Van91I CCANNNNNTGG 1 cut(s) 1216
XapI RAATTY 1 cut(s) 707
XbaI TCTAGA 1 cut(s) 257
XceI RCATGY 1 cut(s) 953
XmiI GTMKAC 2 cut(s) 32, 326
XspI CTAG 1 cut(s) 258
Zsp2I ATGCAT 1 cut(s) 967
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.