Rmu_sc0006598.1_g000014

Protein FAR1-RELATED SEQUENCE 5-like

Design Primers CRISPR Design

Basic Information

Type: gene
Biological Identity
rosa_multiflora
Rmu_sc0006598.1
OG0000414
Physical Location & Seq
Forward (+)
50174 .. 51926
1753 bp
Loading structure...
UTR
Exon/CDS
Intron
Rmu_sc0006598.1_g000014.1.cds

Sequence Viewer

Length: 1041 bp
atgttaggtcttatcttccatggtgggctcgacgagggaacaaggcggagctccggcatggactgcatcattggtagatttgagaaaagagatgagagaagaggtgtgtcgaaggaagagaaggaggagaacggagacggaggcagagaaggaggagagtggagacggaggccgaggcggagagtagttgggtgctggttggaggcggaggatgaggaagaggaggtcggggagaataataagttctttgttacccattttgttgaagagcacaatcatcttcttgtggtgaaagaatgttcccacattcttccttcgcaacggaaagtacaagactatcaaggcattgatatagacttagcacatgattctggaattggtgtcacgtctctatatgagttgatgggtaagcaagcaggtggaagagatgctgttaggtatacaaaacaagatgtgaaaaattaccttagatcaaagagacaaagaagctttgagtatggagaagctggatatattatgaaatatttttcagaccaaacattggaaaacccttcattctaccatgctatgcaattagatagtgaggagcaaataacaaacttattttgggaagatgctaaaatgatcattgattatggccaatttggggatgttgttagttttgatacgacatacaagattaacaaatctaatcgacctctttctgtgttcgttggattcaatcaccaccatgagactattatatttggggtggctttaatgtatgatgaaactgcagattcatttatatggttgtttgagacttttttgagggcaatgtctggaaaggctccaaagacaatatttacagatcaagatgctgcaatggcaaaggctcttcgacatgttatgccagatgcatatcacaggctttgcaaatggcatatgatgcaaaattccataaagcatgggagtagttttttgacagaggatggtggaatcacaagtattttgtcaaggttcatggaaaatattgaggaagatgagtttatatctgcttag
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families
FAR1 MULE SWIM

Protein Analysis

346

Amino Acids

39.95

Weight (kDa)

5.44

Isoelectric Point (pI)

59.26

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready
iTOL Interactive Tree Of Life · Most popular EvolView Flexible annotations MEGA Desktop phylogenetics suite FigTree Desktop tree editor

Orthologous Genes (Group: OG0000414)

Species Orthologous Gene IDs
fragaria_vesca FvH4_1g15941 FvH4_1g22181 FvH4_3g31442 FvH4_4g06832 FvH4_5g15722 FvH4_6g30661 FvH4_7g13761
rosa_chinensis RchiOBHm_Chr3g0478271 RchiOBHm_Chr4g0421141
rosa_laevigata RLG00000002038 RLG00000016047 RLG00000021902 RLG00000024696 RLG00000027779 RLG00000033727 RLG00000035621
rosa_multiflora Rmu_sc0000125.1_g000007 Rmu_sc0000221.1_g000019 Rmu_sc0000221.1_g000020 Rmu_sc0000338.1_g000006 Rmu_sc0000429.1_g000059 Rmu_sc0000429.1_g000060 Rmu_sc0000429.1_g000061 Rmu_sc0000543.1_g000046 Rmu_sc0000689.1_g000008 Rmu_sc0000689.1_g000009 Rmu_sc0001436.1_g000002 Rmu_sc0001634.1_g000004 Rmu_sc0001782.1_g000025 Rmu_sc0002206.1_g000012 Rmu_sc0002985.1_g000008 Rmu_sc0002985.1_g000009 Rmu_sc0003044.1_g000040 Rmu_sc0003044.1_g000041 Rmu_sc0003044.1_g000042 Rmu_sc0003275.1_g000010 Rmu_sc0003561.1_g000002 Rmu_sc0003850.1_g000001 Rmu_sc0003850.1_g000002 Rmu_sc0004092.1_g000039 Rmu_sc0004311.1_g000003 Rmu_sc0004443.1_g000016 Rmu_sc0004542.1_g000002 Rmu_sc0004873.1_g000001 Rmu_sc0005757.1_g000002 Rmu_sc0005964.1_g000004 Rmu_sc0006598.1_g000014 Rmu_sc0006598.1_g000015 Rmu_sc0006889.1_g000023 Rmu_sc0007059.1_g000007 Rmu_sc0007390.1_g000014 Rmu_sc0008085.1_g000015 Rmu_sc0009948.1_g000001 Rmu_sc0010235.1_g000005 Rmu_sc0010665.1_g000022 Rmu_sc0011183.1_g000001 Rmu_sc0021637.1_g000001 Rmu_ssc0000242.1_g000016 Rmu_ssc0000317.1_g000003 Rmu_ssc0000317.1_g000004 Rmu_ssc0000432.1_g000093 Rmu_ssc0000432.1_g000095
rosa_roxburghii Rroxscaffold_1G00024670 Rroxscaffold_1G00047120 Rroxscaffold_4G00283230 Rroxscaffold_5G00365300 Rroxscaffold_7G00192220
rosa_rugosa Rorug03G0325200 Rorug06G0093800 Rorug07G0209800
rosa_samantha Rh1AG084000 Rh1AG202300 Rh1AG294200 Rh1BG259000 Rh2AG357500 Rh2AG389500 Rh2CG376700 Rh2CG468700 Rh2DG441200 Rh2DG504700 Rh2DG505700 Rh3BG359700 Rh3DG120200 Rh4BG161300 Rh4CG087000 Rh5BG550100 Rh5CG573000 Rh6AG284900 Rh6AG426700 Rh7DG285400
rosa_wichuraiana Rw1G030090 Rw2G030600 Rw3G018220 Rw3G027930 Rw4G000900 Rw6G003680 Rw6G036920 Rw6G043190 Rw7G020880

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AarI CACCTGC 1 cut(s) 407
Acc36I ACCTGC 1 cut(s) 407
AccB7I CCANNNNNTGG 1 cut(s) 541
AccI GTMKAC 1 cut(s) 440
AciI CCGC 3 cut(s) 46, 178, 206
AcoI YGGCCR 1 cut(s) 637
AcsI RAATTY 1 cut(s) 934
AfaI GTAC 1 cut(s) 330
AfiI CCNNNNNNNGG 2 cut(s) 541, 646
AflIII ACRYGT 1 cut(s) 883
AgsI TTSAA 2 cut(s) 266, 721
AjiI CACGTC 1 cut(s) 387
AluBI AGCT 3 cut(s) 51, 489, 506
AluI AGCT 3 cut(s) 51, 489, 506
Alw21I GWGCWC 2 cut(s) 53, 273
Alw26I GTCTC 6 cut(s) 129, 157, 393, 472, 728, 794
AoxI GGCC 2 cut(s) 170, 637
ApeKI GCWGC 1 cut(s) 860
ApoI RAATTY 1 cut(s) 934
AsuHPI GGTGA 2 cut(s) 301, 716
BalI TGGCCA 1 cut(s) 639
BanII GRGCYC 2 cut(s) 30, 53
Bbv12I GWGCWC 2 cut(s) 53, 273
BbvI GCAGC 1 cut(s) 847
BccI CCATC 2 cut(s) 397, 965
BclI TGATCA 1 cut(s) 624
BcoDI GTCTC 6 cut(s) 129, 157, 393, 472, 728, 794
BfmI CTRYAG 1 cut(s) 774
BfuAI ACCTGC 1 cut(s) 407
BisI GCNGC 1 cut(s) 861
BlsI GCNGC 1 cut(s) 862
BmgBI CACGTC 1 cut(s) 387
BmiI GGNNCC 1 cut(s) 831
BmsI GCATC 6 cut(s) 75, 418, 604, 847, 886, 918
BsaBI GATNNNNATC 1 cut(s) 900
BsaJI CCNNGG 2 cut(s) 19, 173
Bsc4I CCNNNNNNNGG 2 cut(s) 541, 646
Bse3DI GCAATG 2 cut(s) 822, 870
Bse8I GATNNNNATC 1 cut(s) 900
BseDI CCNNGG 2 cut(s) 19, 173
BseGI GGATG 3 cut(s) 217, 655, 976
BseJI GATNNNNATC 1 cut(s) 900
BseLI CCNNNNNNNGG 2 cut(s) 541, 646
BseMI GCAATG 2 cut(s) 822, 870
BseRI GAGGAG 4 cut(s) 140, 168, 236, 599
BseXI GCAGC 1 cut(s) 847
BshFI GGCC 2 cut(s) 172, 639
BsiHKAI GWGCWC 2 cut(s) 53, 273
BsiSI CCGG 1 cut(s) 54
BslI CCNNNNNNNGG 2 cut(s) 541, 646
BsmAI GTCTC 6 cut(s) 129, 157, 393, 472, 728, 794
BsmBI CGTCTC 3 cut(s) 129, 157, 393
BsnI GGCC 2 cut(s) 172, 639
Bsp1286I GDGCHC 3 cut(s) 30, 53, 273
Bsp143I GATC 3 cut(s) 470, 624, 850
Bsp19I CCATGG 1 cut(s) 19
BspACI CCGC 3 cut(s) 46, 178, 206
BspANI GGCC 2 cut(s) 172, 639
BspLI GGNNCC 1 cut(s) 831
BspMAI CTGCAG 1 cut(s) 778
BspMI ACCTGC 1 cut(s) 407
BspQI GCTCTTC 2 cut(s) 261, 882
BsrDI GCAATG 2 cut(s) 822, 870
BssECI CCNNGG 2 cut(s) 19, 173
BssMI GATC 3 cut(s) 470, 624, 850
BssNAI GTATAC 1 cut(s) 441
BssT1I CCWWGG 1 cut(s) 19
Bst1107I GTATAC 1 cut(s) 441
Bst6I CTCTTC 6 cut(s) 94, 111, 213, 261, 418, 882
BstAPI GCANNNNNTGC 2 cut(s) 63, 928
BstC8I GCNNGC 1 cut(s) 414
BstDEI CTNAG 3 cut(s) 358, 467, 1038
BstDSI CCRYGG 1 cut(s) 19
BstF5I GGATG 3 cut(s) 217, 655, 976
BstKTI GATC 3 cut(s) 473, 627, 853
BstMAI GTCTC 6 cut(s) 129, 157, 393, 472, 728, 794
BstMBI GATC 3 cut(s) 470, 624, 850
BstMWI GCNNNNNNNGC 3 cut(s) 63, 866, 928
BstNSI RCATGY 1 cut(s) 887
BstSFI CTRYAG 1 cut(s) 774
BstV1I GCAGC 1 cut(s) 847
BstZ17I GTATAC 1 cut(s) 441
BsuRI GGCC 2 cut(s) 172, 639
BtgI CCRYGG 1 cut(s) 19
BtrI CACGTC 1 cut(s) 387
BtsCI GGATG 3 cut(s) 217, 655, 976
BveI ACCTGC 1 cut(s) 407
Cac8I GCNNGC 1 cut(s) 414
Csp6I GTAC 1 cut(s) 329
CviAII CATG 8 cut(s) 20, 58, 365, 563, 731, 884, 947, 1003
CviQI GTAC 1 cut(s) 329
DdeI CTNAG 3 cut(s) 358, 467, 1038
DpnI GATC 3 cut(s) 472, 626, 852
DpnII GATC 3 cut(s) 470, 624, 850
EaeI YGGCCR 1 cut(s) 637
Eam1104I CTCTTC 6 cut(s) 94, 111, 213, 261, 418, 882
EarI CTCTTC 6 cut(s) 94, 111, 213, 261, 418, 882
EciI GGCGGA 3 cut(s) 61, 193, 221
Ecl136II GAGCTC 1 cut(s) 51
Eco130I CCWWGG 1 cut(s) 19
Eco24I GRGCYC 2 cut(s) 30, 53
Eco53kI GAGCTC 1 cut(s) 51
EcoICRI GAGCTC 1 cut(s) 51
EcoT14I CCWWGG 1 cut(s) 19
EcoT22I ATGCAT 1 cut(s) 901
EcoT38I GRGCYC 2 cut(s) 30, 53
ErhI CCWWGG 1 cut(s) 19
Esp3I CGTCTC 3 cut(s) 129, 157, 393
FaeI CATG 8 cut(s) 23, 61, 368, 566, 734, 887, 950, 1006
FatI CATG 8 cut(s) 19, 57, 364, 562, 730, 883, 946, 1002
FauNDI CATATG 1 cut(s) 924
FbaI TGATCA 1 cut(s) 624
FblI GTMKAC 1 cut(s) 440
Fnu4HI GCNGC 1 cut(s) 861
FokI GGATG 3 cut(s) 224, 662, 983
FriOI GRGCYC 2 cut(s) 30, 53
Fsp4HI GCNGC 1 cut(s) 861
GluI GCNGC 1 cut(s) 861
HaeIII GGCC 2 cut(s) 172, 639
HapII CCGG 1 cut(s) 54
Hin1II CATG 8 cut(s) 23, 61, 368, 566, 734, 887, 950, 1006
HindIII AAGCTT 1 cut(s) 487
HinfI GANTC 4 cut(s) 368, 717, 779, 978
HpaII CCGG 1 cut(s) 54
HphI GGTGA 2 cut(s) 301, 716
Hpy166II GTNNAC 1 cut(s) 441
Hpy188I TCNGA 1 cut(s) 532
Hpy188III TCNNGA 3 cut(s) 372, 822, 854
Hpy8I GTNNAC 1 cut(s) 441
Hpy99I CGWCG 1 cut(s) 35
HpyAV CCTTC 5 cut(s) 106, 115, 143, 324, 561
HpyCH4IV ACGT 1 cut(s) 386
HpyCH4V TGCA 7 cut(s) 66, 571, 776, 863, 899, 915, 931
HpyF10VI GCNNNNNNNGC 3 cut(s) 63, 866, 928
HpyF3I CTNAG 3 cut(s) 358, 467, 1038
HpySE526I ACGT 1 cut(s) 386
Hsp92II CATG 8 cut(s) 23, 61, 368, 566, 734, 887, 950, 1006
Ksp22I TGATCA 1 cut(s) 624
Kzo9I GATC 3 cut(s) 470, 624, 850
LguI GCTCTTC 2 cut(s) 261, 882
LmnI GCTCC 4 cut(s) 48, 56, 586, 835
LpnPI CCDG 8 cut(s) 67, 181, 357, 402, 492, 807, 892, 906
Lsp1109I GCAGC 1 cut(s) 847
LweI GCATC 6 cut(s) 75, 418, 604, 847, 886, 918
MaeII ACGT 1 cut(s) 386
MaeIII GTNAC 2 cut(s) 250, 382
MalI GATC 3 cut(s) 472, 626, 852
MboI GATC 3 cut(s) 470, 624, 850
MhlI GDGCHC 3 cut(s) 30, 53, 273
MlsI TGGCCA 1 cut(s) 639
MluCI AATT 5 cut(s) 375, 460, 572, 641, 934
MluNI TGGCCA 1 cut(s) 639
MmeI TCCRAC 2 cut(s) 180, 694
Mox20I TGGCCA 1 cut(s) 639
Mph1103I ATGCAT 1 cut(s) 901
MscI TGGCCA 1 cut(s) 639
MseI TTAA 2 cut(s) 681, 758
MslI CAYNNNNRTG 2 cut(s) 729, 787
Msp20I TGGCCA 1 cut(s) 639
MspI CCGG 1 cut(s) 54
MwoI GCNNNNNNNGC 3 cut(s) 63, 866, 928
NcoI CCATGG 1 cut(s) 19
NdeI CATATG 1 cut(s) 924
NdeII GATC 3 cut(s) 470, 624, 850
NlaIII CATG 8 cut(s) 23, 61, 368, 566, 734, 887, 950, 1006
NlaIV GGNNCC 1 cut(s) 831
NmeAIII GCCGAG 1 cut(s) 198
NmuCI GTSAC 1 cut(s) 382
NsiI ATGCAT 1 cut(s) 901
NspI RCATGY 1 cut(s) 887
PaqCI CACCTGC 1 cut(s) 407
PciI ACATGT 1 cut(s) 883
PciSI GCTCTTC 2 cut(s) 261, 882
PfeI GAWTC 4 cut(s) 368, 717, 779, 978
PflMI CCANNNNNTGG 1 cut(s) 541
PkrI GCNGC 1 cut(s) 862
PscI ACATGT 1 cut(s) 883
Psp124BI GAGCTC 1 cut(s) 53
PspN4I GGNNCC 1 cut(s) 831
PstI CTGCAG 1 cut(s) 778
RsaI GTAC 1 cut(s) 330
RsaNI GTAC 1 cut(s) 329
RseI CAYNNNNRTG 2 cut(s) 729, 787
SacI GAGCTC 1 cut(s) 53
SapI GCTCTTC 2 cut(s) 261, 882
SaqAI TTAA 2 cut(s) 681, 758
SatI GCNGC 1 cut(s) 861
Sau3AI GATC 3 cut(s) 470, 624, 850
SduI GDGCHC 3 cut(s) 30, 53, 273
SfaNI GCATC 6 cut(s) 75, 418, 604, 847, 886, 918
SfcI CTRYAG 1 cut(s) 774
SmiMI CAYNNNNRTG 2 cut(s) 729, 787
Sse9I AATT 5 cut(s) 375, 460, 572, 641, 934
SsiI CCGC 3 cut(s) 46, 178, 206
SspI AATATT 3 cut(s) 524, 843, 1012
SstI GAGCTC 1 cut(s) 53
StyI CCWWGG 1 cut(s) 19
TaiI ACGT 1 cut(s) 389
TaqI TCGA 4 cut(s) 30, 110, 694, 880
TasI AATT 5 cut(s) 375, 460, 572, 641, 934
TatI WGTACW 1 cut(s) 328
TfiI GAWTC 4 cut(s) 368, 717, 779, 978
Tru1I TTAA 2 cut(s) 681, 758
Tru9I TTAA 2 cut(s) 681, 758
TseFI GTSAC 1 cut(s) 382
TseI GCWGC 1 cut(s) 860
Tsp45I GTSAC 1 cut(s) 382
TspDTI ATGAA 5 cut(s) 533, 543, 771, 783, 991
TspGWI ACGGA 4 cut(s) 147, 153, 181, 337
Van91I CCANNNNNTGG 1 cut(s) 541
XapI RAATTY 1 cut(s) 934
XceI RCATGY 1 cut(s) 887
XmiI GTMKAC 1 cut(s) 440
Zsp2I ATGCAT 1 cut(s) 901
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.