Rmu_sc0010235.1_g000005

FAR1-related protein

Design Primers CRISPR Design

Basic Information

Type: gene
Biological Identity
rosa_multiflora
Rmu_sc0010235.1
OG0000414
Physical Location & Seq
Forward (+)
25908 .. 27521
1614 bp
Loading structure...
UTR
Exon/CDS
Intron
Rmu_sc0010235.1_g000005.1.cds

Sequence Viewer

Length: 1614 bp
atggcctatggagaagcaggcagcctcttgaggtatttacacaatcaatcttgtgagaatccctcatttcaatatgcagtacaattggatagtgaagaacagattacaaatatattttgggcagatacaagaatgattattgcttatgctcattttggcgatgtcattactttcgacaccacgtacagtgctaataaagaatataggccttttggggtattttctgggtttaatcatcacagagagactgtactatttggggctgcactcctttatgatgagacggctgaatcttttaagtggttgttccaaacattcttagaagcacataagcaaaaaaagccaaagactatatttacataccaagatcctgcaatggcaaaggcattggccgaggtacttccagatacgttccatggattatgtagttggcatataatgcaaaatggaatcaagcatttgggatacctaatgaaggatggctcattttttcttacagaatttgcagcatgcatgtatgagcacgaggaagagaaagaatttgaagatgcttggaatgctatgctatgcaaatataatgtttgtagcaatccatggttggaaaagatatatgaaattaaggagaaatggactaaatgttacatgaaagaggtatttacaattggaatgcgaagtacacagattggtgaaagcctgaacagtgatttaaaagcttacttaaagtcagacatggatatcatgcgtttttttaaacagtttgaaagggttgctaatgaaaagcactataaggagttagaatctgagtataattctagacaaaagctaccaagagtgcaggtacaaaaatcgcctgtactacaacaagcagcgaaaatttatactccatcaatcttcgaaaagtatttccaagaagaatttgattggtcttcagcagctattataaaacagcgtgaggaatctactcatacacatgagtatacgattgccattgtagatgaaaaaagagagcataaggagcataaggtgaaatttcaaacttcagaccaaagtatcttatgcagttgcatgaaatttcagagttttggaattttgtgttgtcatgctctgaaagttcttgatgtatgggatattaaaagaattcctgatcaagatattcttaagaggtggactagggaggcaagaaatgaggctgttgcaagcatgaatgaagccaatgtaatggaagataagaaattgactatagctgagcgatatagaacagcttgccctatattagttgatattgcatctcgagcatctggagatgaaaaagcctttgaattggtaatgaaaatcgcacatgagttaagaaaacaggttgaagacatcttcttggacaactcaacaacgagtattgatgaactgcataattcttcgcaaggtgggggtgagaggatggttcaagaaagtcaaattgaaagcttacttcagaaggcaaaaggtttgaagaagaaaaacaattgtaaaggtctcaaaaaacgcccatcaagaaagagaaatacaagatcgtctaataaggatcaatcattacctcaagcatctcaggtaacaaagatttttatcatgcatatatga
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families
FAR1 MULE SWIM

Protein Analysis

537

Amino Acids

62.58

Weight (kDa)

7.01

Isoelectric Point (pI)

48.81

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready
iTOL Interactive Tree Of Life · Most popular EvolView Flexible annotations MEGA Desktop phylogenetics suite FigTree Desktop tree editor

Orthologous Genes (Group: OG0000414)

Species Orthologous Gene IDs
fragaria_vesca FvH4_1g15941 FvH4_1g22181 FvH4_3g31442 FvH4_4g06832 FvH4_5g15722 FvH4_6g30661 FvH4_7g13761
rosa_chinensis RchiOBHm_Chr3g0478271 RchiOBHm_Chr4g0421141
rosa_laevigata RLG00000002038 RLG00000016047 RLG00000021902 RLG00000024696 RLG00000027779 RLG00000033727 RLG00000035621
rosa_multiflora Rmu_sc0000125.1_g000007 Rmu_sc0000221.1_g000019 Rmu_sc0000221.1_g000020 Rmu_sc0000338.1_g000006 Rmu_sc0000429.1_g000059 Rmu_sc0000429.1_g000060 Rmu_sc0000429.1_g000061 Rmu_sc0000543.1_g000046 Rmu_sc0000689.1_g000008 Rmu_sc0000689.1_g000009 Rmu_sc0001436.1_g000002 Rmu_sc0001634.1_g000004 Rmu_sc0001782.1_g000025 Rmu_sc0002206.1_g000012 Rmu_sc0002985.1_g000008 Rmu_sc0002985.1_g000009 Rmu_sc0003044.1_g000040 Rmu_sc0003044.1_g000041 Rmu_sc0003044.1_g000042 Rmu_sc0003275.1_g000010 Rmu_sc0003561.1_g000002 Rmu_sc0003850.1_g000001 Rmu_sc0003850.1_g000002 Rmu_sc0004092.1_g000039 Rmu_sc0004311.1_g000003 Rmu_sc0004443.1_g000016 Rmu_sc0004542.1_g000002 Rmu_sc0004873.1_g000001 Rmu_sc0005757.1_g000002 Rmu_sc0005964.1_g000004 Rmu_sc0006598.1_g000014 Rmu_sc0006598.1_g000015 Rmu_sc0006889.1_g000023 Rmu_sc0007059.1_g000007 Rmu_sc0007390.1_g000014 Rmu_sc0008085.1_g000015 Rmu_sc0009948.1_g000001 Rmu_sc0010235.1_g000005 Rmu_sc0010665.1_g000022 Rmu_sc0011183.1_g000001 Rmu_sc0021637.1_g000001 Rmu_ssc0000242.1_g000016 Rmu_ssc0000317.1_g000003 Rmu_ssc0000317.1_g000004 Rmu_ssc0000432.1_g000093 Rmu_ssc0000432.1_g000095
rosa_roxburghii Rroxscaffold_1G00024670 Rroxscaffold_1G00047120 Rroxscaffold_4G00283230 Rroxscaffold_5G00365300 Rroxscaffold_7G00192220
rosa_rugosa Rorug03G0325200 Rorug06G0093800 Rorug07G0209800
rosa_samantha Rh1AG084000 Rh1AG202300 Rh1AG294200 Rh1BG259000 Rh2AG357500 Rh2AG389500 Rh2CG376700 Rh2CG468700 Rh2DG441200 Rh2DG504700 Rh2DG505700 Rh3BG359700 Rh3DG120200 Rh4BG161300 Rh4CG087000 Rh5BG550100 Rh5CG573000 Rh6AG284900 Rh6AG426700 Rh7DG285400
rosa_wichuraiana Rw1G030090 Rw2G030600 Rw3G018220 Rw3G027930 Rw4G000900 Rw6G003680 Rw6G036920 Rw6G043190 Rw7G020880

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AanI TTATAA 1 cut(s) 941
Acc36I ACCTGC 1 cut(s) 826
AccI GTMKAC 1 cut(s) 977
AclWI GGATC 2 cut(s) 362, 1566
AcoI YGGCCR 1 cut(s) 390
AcsI RAATTY 8 cut(s) 500, 539, 873, 914, 1028, 1070, 1086, 1137
AcuI CTGAAG 3 cut(s) 912, 1023, 1451
AfaI GTAC 7 cut(s) 81, 185, 252, 399, 676, 840, 855
AfiI CCNNNNNNNGG 1 cut(s) 475
AflII CTTAAG 1 cut(s) 1157
AgsI TTSAA 9 cut(s) 71, 545, 761, 1034, 1319, 1361, 1442, 1457, 1486
AluBI AGCT 6 cut(s) 713, 823, 935, 1244, 1262, 1461
AluI AGCT 6 cut(s) 713, 823, 935, 1244, 1262, 1461
Alw21I GWGCWC 1 cut(s) 525
Alw26I GTCTC 3 cut(s) 239, 275, 1514
AlwI GGATC 2 cut(s) 362, 1566
Ama87I CYCGRG 1 cut(s) 1290
AoxI GGCC 3 cut(s) 3, 206, 390
ApeKI GCWGC 5 cut(s) 21, 263, 506, 866, 932
ApoI RAATTY 8 cut(s) 500, 539, 873, 914, 1028, 1070, 1086, 1137
AsuHPI GGTGA 3 cut(s) 698, 1036, 1439
AsuII TTCGAA 1 cut(s) 894
AvaI CYCGRG 1 cut(s) 1290
BaeI ACNNNNGTAYC 2 cut(s) 1033, 1066
BauI CACGAG 1 cut(s) 524
BbsI GAAGAC 2 cut(s) 918, 1368
Bbv12I GWGCWC 1 cut(s) 525
BbvI GCAGC 5 cut(s) 33, 250, 518, 878, 944
BccI CCATC 4 cut(s) 473, 892, 1429, 1531
BceAI ACGGC 1 cut(s) 300
BciVI GTATCC 1 cut(s) 458
BclI TGATCA 1 cut(s) 1144
BcoDI GTCTC 3 cut(s) 239, 275, 1514
BfaI CTAG 2 cut(s) 813, 1170
BfmI CTRYAG 1 cut(s) 1239
BfrI CTTAAG 1 cut(s) 1157
BfuAI ACCTGC 1 cut(s) 826
BfuI GTATCC 1 cut(s) 458
BisI GCNGC 5 cut(s) 22, 264, 507, 867, 933
BlpI GCTNAGC 1 cut(s) 1245
BlsI GCNGC 5 cut(s) 23, 265, 508, 868, 934
BmeT110I CYCGRG 1 cut(s) 1290
BmsI GCATC 4 cut(s) 538, 1295, 1304, 1586
BpiI GAAGAC 2 cut(s) 918, 1368
BplI GAGNNNNNCTC 2 cut(s) 47, 79
BpmI CTGGAG 1 cut(s) 1320
Bpu1102I GCTNAGC 1 cut(s) 1245
Bpu14I TTCGAA 1 cut(s) 894
BpuEI CTTGAG 2 cut(s) 49, 1557
BsaAI YACGTR 1 cut(s) 183
BsaBI GATNNNNATC 1 cut(s) 1598
BsaI GGTCTC 1 cut(s) 1514
BsaJI CCNNGG 3 cut(s) 393, 415, 593
Bsc4I CCNNNNNNNGG 1 cut(s) 475
Bse3DI GCAATG 1 cut(s) 381
Bse8I GATNNNNATC 1 cut(s) 1598
BseDI CCNNGG 3 cut(s) 393, 415, 593
BseGI GGATG 2 cut(s) 484, 1440
BseJI GATNNNNATC 1 cut(s) 1598
BseLI CCNNNNNNNGG 1 cut(s) 475
BseMI GCAATG 1 cut(s) 381
BseMII CTCAG 3 cut(s) 792, 1236, 1595
BseXI GCAGC 5 cut(s) 33, 250, 518, 878, 944
BsgI GTGCAG 2 cut(s) 249, 854
BshFI GGCC 3 cut(s) 5, 208, 392
BsiHKAI GWGCWC 1 cut(s) 525
BsiHKCI CYCGRG 1 cut(s) 1290
BslI CCNNNNNNNGG 1 cut(s) 475
BsmAI GTCTC 3 cut(s) 239, 275, 1514
BsmBI CGTCTC 1 cut(s) 275
BsmI GAATGC 2 cut(s) 562, 672
BsnI GGCC 3 cut(s) 5, 208, 392
Bso31I GGTCTC 1 cut(s) 1514
BsoBI CYCGRG 1 cut(s) 1290
Bsp119I TTCGAA 1 cut(s) 894
Bsp1286I GDGCHC 1 cut(s) 525
Bsp143I GATC 4 cut(s) 367, 1144, 1544, 1558
Bsp1720I GCTNAGC 1 cut(s) 1245
Bsp19I CCATGG 2 cut(s) 415, 593
BspANI GGCC 3 cut(s) 5, 208, 392
BspCNI CTCAG 3 cut(s) 793, 1237, 1594
BspMI ACCTGC 1 cut(s) 826
BspPI GGATC 2 cut(s) 362, 1566
BspT104I TTCGAA 1 cut(s) 894
BspTI CTTAAG 1 cut(s) 1157
BspTNI GGTCTC 1 cut(s) 1514
BsrDI GCAATG 1 cut(s) 381
BssECI CCNNGG 3 cut(s) 393, 415, 593
BssMI GATC 4 cut(s) 367, 1144, 1544, 1558
BssNAI GTATAC 1 cut(s) 978
BssSI CACGAG 1 cut(s) 524
BssT1I CCWWGG 2 cut(s) 415, 593
Bst1107I GTATAC 1 cut(s) 978
Bst2BI CACGAG 1 cut(s) 524
Bst4CI ACNGT 4 cut(s) 188, 250, 701, 756
Bst6I CTCTTC 1 cut(s) 525
BstAFI CTTAAG 1 cut(s) 1157
BstAPI GCANNNNNTGC 1 cut(s) 439
BstBAI YACGTR 1 cut(s) 183
BstBI TTCGAA 1 cut(s) 894
BstC8I GCNNGC 4 cut(s) 19, 511, 1198, 1264
BstDEI CTNAG 4 cut(s) 319, 801, 1245, 1581
BstDSI CCRYGG 2 cut(s) 415, 593
BstENI CCTNNNNNAGG 1 cut(s) 473
BstF5I GGATG 2 cut(s) 484, 1440
BstKTI GATC 4 cut(s) 370, 1147, 1547, 1561
BstMAI GTCTC 3 cut(s) 239, 275, 1514
BstMBI GATC 4 cut(s) 367, 1144, 1544, 1558
BstMWI GCNNNNNNNGC 5 cut(s) 340, 439, 557, 1015, 1292
BstNSI RCATGY 2 cut(s) 513, 517
BstSFI CTRYAG 1 cut(s) 1239
BstV1I GCAGC 5 cut(s) 33, 250, 518, 878, 944
BstV2I GAAGAC 2 cut(s) 918, 1368
BstX2I RGATCY 1 cut(s) 367
BstXI CCANNNNNNTGG 1 cut(s) 1219
BstYI RGATCY 1 cut(s) 367
BstZ17I GTATAC 1 cut(s) 978
BsuI GTATCC 1 cut(s) 458
BsuRI GGCC 3 cut(s) 5, 208, 392
BtgI CCRYGG 2 cut(s) 415, 593
BtgZI GCGATG 1 cut(s) 174
BtsCI GGATG 2 cut(s) 484, 1440
BtsIMutI CAGTG 2 cut(s) 193, 706
BveI ACCTGC 1 cut(s) 826
Cac8I GCNNGC 4 cut(s) 19, 511, 1198, 1264
Csp6I GTAC 7 cut(s) 80, 184, 251, 398, 675, 839, 854
CviQI GTAC 7 cut(s) 80, 184, 251, 398, 675, 839, 854
DdeI CTNAG 4 cut(s) 319, 801, 1245, 1581
DpnI GATC 4 cut(s) 369, 1146, 1546, 1560
DpnII GATC 4 cut(s) 367, 1144, 1544, 1558
DraI TTTAAA 2 cut(s) 708, 751
EaeI YGGCCR 1 cut(s) 390
Eam1104I CTCTTC 1 cut(s) 525
EarI CTCTTC 1 cut(s) 525
Eco130I CCWWGG 2 cut(s) 415, 593
Eco147I AGGCCT 1 cut(s) 208
Eco31I GGTCTC 1 cut(s) 1514
Eco32I GATATC 1 cut(s) 736
Eco57I CTGAAG 3 cut(s) 912, 1023, 1451
Eco88I CYCGRG 1 cut(s) 1290
EcoNI CCTNNNNNAGG 1 cut(s) 473
EcoRI GAATTC 1 cut(s) 1137
EcoRV GATATC 1 cut(s) 736
EcoT14I CCWWGG 2 cut(s) 415, 593
EcoT22I ATGCAT 2 cut(s) 515, 1608
ErhI CCWWGG 2 cut(s) 415, 593
Esp3I CGTCTC 1 cut(s) 275
FalI AAGNNNNNCTT 2 cut(s) 1140, 1172
FbaI TGATCA 1 cut(s) 1144
FblI GTMKAC 1 cut(s) 977
Fnu4HI GCNGC 5 cut(s) 22, 264, 507, 867, 933
FokI GGATG 2 cut(s) 491, 1447
Fsp4HI GCNGC 5 cut(s) 22, 264, 507, 867, 933
FspBI CTAG 2 cut(s) 813, 1170
GluI GCNGC 5 cut(s) 22, 264, 507, 867, 933
GsuI CTGGAG 1 cut(s) 1320
HaeIII GGCC 3 cut(s) 5, 208, 392
HindIII AAGCTT 2 cut(s) 711, 1459
HinfI GANTC 5 cut(s) 58, 290, 450, 797, 956
HphI GGTGA 3 cut(s) 698, 1036, 1439
Hpy166II GTNNAC 3 cut(s) 677, 978, 1167
Hpy188I TCNGA 6 cut(s) 727, 802, 1042, 1077, 1107, 1470
Hpy8I GTNNAC 3 cut(s) 677, 978, 1167
HpyAV CCTTC 2 cut(s) 469, 1465
HpyCH4III ACNGT 4 cut(s) 188, 250, 701, 756
HpyCH4IV ACGT 2 cut(s) 182, 410
HpyF10VI GCNNNNNNNGC 5 cut(s) 340, 439, 557, 1015, 1292
HpyF3I CTNAG 4 cut(s) 319, 801, 1245, 1581
HpySE526I ACGT 2 cut(s) 182, 410
Ksp22I TGATCA 1 cut(s) 1144
Kzo9I GATC 4 cut(s) 367, 1144, 1544, 1558
LmnI GCTCC 1 cut(s) 1015
Lsp1109I GCAGC 5 cut(s) 33, 250, 518, 878, 944
LweI GCATC 4 cut(s) 538, 1295, 1304, 1586
MaeI CTAG 2 cut(s) 813, 1170
MaeII ACGT 2 cut(s) 182, 410
MaeIII GTNAC 2 cut(s) 638, 1585
MalI GATC 4 cut(s) 369, 1146, 1546, 1560
MboI GATC 4 cut(s) 367, 1144, 1544, 1558
MfeI CAATTG 3 cut(s) 83, 660, 1498
MflI RGATCY 1 cut(s) 367
MhlI GDGCHC 1 cut(s) 525
MmeI TCCRAC 1 cut(s) 579
Mph1103I ATGCAT 2 cut(s) 515, 1608
MseI TTAA 9 cut(s) 231, 297, 618, 707, 719, 750, 1131, 1158, 1346
MslI CAYNNNNRTG 1 cut(s) 969
MspCI CTTAAG 1 cut(s) 1157
MunI CAATTG 3 cut(s) 83, 660, 1498
Mva1269I GAATGC 2 cut(s) 562, 672
MwoI GCNNNNNNNGC 5 cut(s) 340, 439, 557, 1015, 1292
NcoI CCATGG 2 cut(s) 415, 593
NdeII GATC 4 cut(s) 367, 1144, 1544, 1558
NmeAIII GCCGAG 1 cut(s) 418
NsiI ATGCAT 2 cut(s) 515, 1608
NspI RCATGY 2 cut(s) 513, 517
NspV TTCGAA 1 cut(s) 894
PaeI GCATGC 1 cut(s) 513
PaeR7I CTCGAG 1 cut(s) 1290
PceI AGGCCT 1 cut(s) 208
PctI GAATGC 2 cut(s) 562, 672
PfeI GAWTC 5 cut(s) 58, 290, 450, 797, 956
PkrI GCNGC 5 cut(s) 23, 265, 508, 868, 934
Ppu21I YACGTR 1 cut(s) 183
PsiI TTATAA 1 cut(s) 941
PsuI RGATCY 1 cut(s) 367
RsaI GTAC 7 cut(s) 81, 185, 252, 399, 676, 840, 855
RsaNI GTAC 7 cut(s) 80, 184, 251, 398, 675, 839, 854
RseI CAYNNNNRTG 1 cut(s) 969
SaqAI TTAA 9 cut(s) 231, 297, 618, 707, 719, 750, 1131, 1158, 1346
SatI GCNGC 5 cut(s) 22, 264, 507, 867, 933
Sau3AI GATC 4 cut(s) 367, 1144, 1544, 1558
SduI GDGCHC 1 cut(s) 525
SfaNI GCATC 4 cut(s) 538, 1295, 1304, 1586
SfcI CTRYAG 1 cut(s) 1239
Sfr274I CTCGAG 1 cut(s) 1290
SfuI TTCGAA 1 cut(s) 894
SlaI CTCGAG 1 cut(s) 1290
SmiMI CAYNNNNRTG 1 cut(s) 969
SmlI CTYRAG 4 cut(s) 28, 1157, 1290, 1572
SmoI CTYRAG 4 cut(s) 28, 1157, 1290, 1572
SphI GCATGC 1 cut(s) 513
SseBI AGGCCT 1 cut(s) 208
SspMI CTAG 2 cut(s) 813, 1170
StuI AGGCCT 1 cut(s) 208
StyI CCWWGG 2 cut(s) 415, 593
TaaI ACNGT 4 cut(s) 188, 250, 701, 756
TaiI ACGT 2 cut(s) 185, 413
TaqI TCGA 3 cut(s) 174, 894, 1291
TatI WGTACW 4 cut(s) 79, 250, 674, 853
TfiI GAWTC 5 cut(s) 58, 290, 450, 797, 956
Tru1I TTAA 9 cut(s) 231, 297, 618, 707, 719, 750, 1131, 1158, 1346
Tru9I TTAA 9 cut(s) 231, 297, 618, 707, 719, 750, 1131, 1158, 1346
TscAI CASTG 2 cut(s) 193, 706
TseI GCWGC 5 cut(s) 21, 263, 506, 866, 932
TspRI CASTG 2 cut(s) 193, 706
Vha464I CTTAAG 1 cut(s) 1157
XagI CCTNNNNNAGG 1 cut(s) 473
XapI RAATTY 8 cut(s) 500, 539, 873, 914, 1028, 1070, 1086, 1137
XbaI TCTAGA 1 cut(s) 812
XceI RCATGY 2 cut(s) 513, 517
XhoI CTCGAG 1 cut(s) 1290
XmiI GTMKAC 1 cut(s) 977
XspI CTAG 2 cut(s) 813, 1170
Zsp2I ATGCAT 2 cut(s) 515, 1608
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.