Rmu_sc0010665.1_g000022

FAR1-related protein

Basic Information

Type: gene
Biological Identity
rosa_multiflora
Rmu_sc0010665.1
Physical Location & Seq
Reverse (-)
64698 .. 66074
1377 bp
Loading structure...
UTR
Exon/CDS
Intron
Rmu_sc0010665.1_g000022.1.cds

Sequence Viewer

Length: 1254 bp
atggaattggtacaagattattctggaatcccattgaagctttcattcgagttaatgggcagagaagttggtggaagagaggctcttggattcactaaacaagatcagaaaaattatcttcaatctcagaggcaaaagaaattggaatatggagaagcaggatgcttattaaaatacttcctaaatcaagcattagaaaatccctcatttttctatgttgtgcaattggatagtgatgagcaaataacaaatattttttgggctgatgctaggatgatacttgattatggtttatttggttatgttgtgatttttgacactacatatagaactaatgaagccaatcgtccatttggagtatttgcgggatttaatcatcatcatgagacaataatctttggggcagcattgatgtatgatgacacttcttattcgtttgcatggttatttgagacgtttttggaggtaatgtctaacaaggctccaaagtctatttttaccgatcaagatgctgcaatggctaaagcttgtgcaaatgtgatgcctaacacatatcacttgctttgcacacggcatataatgcaaaatgccattaagaaagcaagtagtatattcgagggtgatgatagggtcaccaccttcttatcaaaatgtatgaataactatgaagaggaggatgagttcctagttgtatgggaagcaatgcttactgaatatggtgcgcatgataatccttggttaagtgattatgatgtggttcaatttttcaagcacattgacagattgctcaatgataagcggtataaagagttagaggcagagtatgctttgtgctacaagttacctactattgggatattttcttcaatggtgatcaagtctggaaatatttacactaaagcagtatttgaagaattccaaattcagtatgagaaggctcttgactacaacttagtcggatgtattcaagatggtgatgacattgtgtataaagttgtctttaatggtcattcaaagcagagatgtgttagggtgaagaaagaccattcagtatcttgtagttgtaggttgtttgagattgaaggtgttttgtgccgccatgcaataaaaatccttactaactatatgaatgtcaaagaaattcctgatcagtatattttaaaaaggtggacaagaaaagcaatatctgaaagagtgaaagacatgtatggccaagacatccaagtagataccaacctacaacaaacatcttga
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families

Protein Analysis

417

Amino Acids

48.44

Weight (kDa)

5.4

Isoelectric Point (pI)

37.01

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Orthologous Genes (Group: OG0000414)

Species Orthologous Gene IDs
fragaria_vesca FvH4_1g15941 FvH4_1g22181 FvH4_3g31442 FvH4_4g06832 FvH4_5g15722 FvH4_6g30661 FvH4_7g13761
rosa_chinensis RchiOBHm_Chr3g0478271 RchiOBHm_Chr4g0421141
rosa_laevigata RLG00000002038 RLG00000016047 RLG00000021902 RLG00000024696 RLG00000027779 RLG00000033727 RLG00000035621
rosa_multiflora Rmu_sc0000125.1_g000007 Rmu_sc0000221.1_g000019 Rmu_sc0000221.1_g000020 Rmu_sc0000338.1_g000006 Rmu_sc0000429.1_g000059 Rmu_sc0000429.1_g000060 Rmu_sc0000429.1_g000061 Rmu_sc0000543.1_g000046 Rmu_sc0000689.1_g000008 Rmu_sc0000689.1_g000009 Rmu_sc0001436.1_g000002 Rmu_sc0001634.1_g000004 Rmu_sc0001782.1_g000025 Rmu_sc0002206.1_g000012 Rmu_sc0002985.1_g000008 Rmu_sc0002985.1_g000009 Rmu_sc0003044.1_g000040 Rmu_sc0003044.1_g000041 Rmu_sc0003044.1_g000042 Rmu_sc0003275.1_g000010 Rmu_sc0003561.1_g000002 Rmu_sc0003850.1_g000001 Rmu_sc0003850.1_g000002 Rmu_sc0004092.1_g000039 Rmu_sc0004311.1_g000003 Rmu_sc0004443.1_g000016 Rmu_sc0004542.1_g000002 Rmu_sc0004873.1_g000001 Rmu_sc0005757.1_g000002 Rmu_sc0005964.1_g000004 Rmu_sc0006598.1_g000014 Rmu_sc0006598.1_g000015 Rmu_sc0006889.1_g000023 Rmu_sc0007059.1_g000007 Rmu_sc0007390.1_g000014 Rmu_sc0008085.1_g000015 Rmu_sc0009948.1_g000001 Rmu_sc0010235.1_g000005 Rmu_sc0010665.1_g000022 Rmu_sc0011183.1_g000001 Rmu_sc0021637.1_g000001 Rmu_ssc0000242.1_g000016 Rmu_ssc0000317.1_g000003 Rmu_ssc0000317.1_g000004 Rmu_ssc0000432.1_g000093 Rmu_ssc0000432.1_g000095
rosa_roxburghii Rroxscaffold_1G00024670 Rroxscaffold_1G00047120 Rroxscaffold_4G00283230 Rroxscaffold_5G00365300 Rroxscaffold_7G00192220
rosa_rugosa Rorug03G0325200 Rorug06G0093800 Rorug07G0209800
rosa_samantha Rh1AG084000 Rh1AG202300 Rh1AG294200 Rh1BG259000 Rh2AG357500 Rh2AG389500 Rh2CG376700 Rh2CG468700 Rh2DG441200 Rh2DG504700 Rh2DG505700 Rh3BG359700 Rh3DG120200 Rh4BG161300 Rh4CG087000 Rh5BG550100 Rh5CG573000 Rh6AG284900 Rh6AG426700 Rh7DG285400
rosa_wichuraiana Rw1G030090 Rw2G030600 Rw3G018220 Rw3G027930 Rw4G000900 Rw6G003680 Rw6G036920 Rw6G043190 Rw7G020880

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
Acc16I TGCGCA 1 cut(s) 723
AciI CCGC 3 cut(s) 365, 799, 1096
AcoI YGGCCR 1 cut(s) 1210
AcsI RAATTY 3 cut(s) 914, 921, 1140
AfaI GTAC 1 cut(s) 12
AfiI CCNNNNNNNGG 1 cut(s) 851
AflIII ACRYGT 1 cut(s) 1203
AgsI TTSAA 9 cut(s) 37, 122, 761, 769, 867, 911, 968, 1014, 1082
AloI GAACNNNNNNTCC 2 cut(s) 665, 697
AluBI AGCT 2 cut(s) 40, 527
AluI AGCT 2 cut(s) 40, 527
Alw26I GTCTC 2 cut(s) 380, 446
AoxI GGCC 1 cut(s) 1210
ApeKI GCWGC 2 cut(s) 404, 512
ApoI RAATTY 3 cut(s) 914, 921, 1140
AspLEI GCGC 1 cut(s) 724
AsuHPI GGTGA 5 cut(s) 625, 632, 883, 986, 1045
BalI TGGCCA 1 cut(s) 1212
BbvI GCAGC 2 cut(s) 416, 499
BccI CCATC 1 cut(s) 965
BceAI ACGGC 1 cut(s) 587
BcgI CGANNNNNNTGC 2 cut(s) 491, 525
BclI TGATCA 2 cut(s) 873, 1147
BcoDI GTCTC 2 cut(s) 380, 446
BfaI CTAG 2 cut(s) 270, 686
BisI GCNGC 3 cut(s) 405, 513, 1096
BlsI GCNGC 3 cut(s) 406, 514, 1097
BmiI GGNNCC 1 cut(s) 483
BmsI GCATC 4 cut(s) 152, 256, 499, 531
BsaJI CCNNGG 1 cut(s) 734
BsaXI ACNNNNNCTCC 4 cut(s) 455, 485, 665, 695
Bsc4I CCNNNNNNNGG 1 cut(s) 851
Bse3DI GCAATG 2 cut(s) 522, 708
BseDI CCNNGG 1 cut(s) 734
BseGI GGATG 5 cut(s) 167, 279, 682, 965, 1218
BseLI CCNNNNNNNGG 1 cut(s) 851
BseMI GCAATG 2 cut(s) 522, 708
BseMII CTCAG 1 cut(s) 140
BseRI GAGGAG 1 cut(s) 686
BseXI GCAGC 2 cut(s) 416, 499
BshFI GGCC 1 cut(s) 1212
BslI CCNNNNNNNGG 1 cut(s) 851
BsmAI GTCTC 2 cut(s) 380, 446
BsmBI CGTCTC 1 cut(s) 446
BsnI GGCC 1 cut(s) 1212
Bsp143I GATC 4 cut(s) 103, 502, 873, 1147
BspACI CCGC 3 cut(s) 365, 799, 1096
BspANI GGCC 1 cut(s) 1212
BspCNI CTCAG 1 cut(s) 139
BspHI TCATGA 1 cut(s) 382
BspLI GGNNCC 1 cut(s) 483
BsrDI GCAATG 2 cut(s) 522, 708
BssECI CCNNGG 1 cut(s) 734
BssMI GATC 4 cut(s) 103, 502, 873, 1147
BssT1I CCWWGG 1 cut(s) 734
Bst6I CTCTTC 2 cut(s) 70, 663
BstAPI GCANNNNNTGC 2 cut(s) 580, 824
BstDEI CTNAG 2 cut(s) 126, 952
BstEII GGTNACC 1 cut(s) 631
BstF5I GGATG 5 cut(s) 167, 279, 682, 965, 1218
BstHHI GCGC 1 cut(s) 724
BstKTI GATC 4 cut(s) 106, 505, 876, 1150
BstMAI GTCTC 2 cut(s) 380, 446
BstMBI GATC 4 cut(s) 103, 502, 873, 1147
BstMWI GCNNNNNNNGC 3 cut(s) 518, 580, 824
BstNSI RCATGY 1 cut(s) 1207
BstPI GGTNACC 1 cut(s) 631
BstV1I GCAGC 2 cut(s) 416, 499
BsuRI GGCC 1 cut(s) 1212
BtsCI GGATG 5 cut(s) 167, 279, 682, 965, 1218
CciI TCATGA 1 cut(s) 382
CfoI GCGC 1 cut(s) 724
Csp6I GTAC 1 cut(s) 11
CviAII CATG 5 cut(s) 383, 441, 725, 1100, 1204
CviJI RGCY 9 cut(s) 40, 83, 263, 341, 482, 521, 527, 938, 1212
CviKI_1 RGCY 9 cut(s) 40, 83, 263, 341, 482, 521, 527, 938, 1212
CviQI GTAC 1 cut(s) 11
DdeI CTNAG 2 cut(s) 126, 952
DpnI GATC 4 cut(s) 105, 504, 875, 1149
DpnII GATC 4 cut(s) 103, 502, 873, 1147
DraI TTTAAA 1 cut(s) 1161
EaeI YGGCCR 1 cut(s) 1210
Eam1104I CTCTTC 2 cut(s) 70, 663
EarI CTCTTC 2 cut(s) 70, 663
Eco130I CCWWGG 1 cut(s) 734
Eco91I GGTNACC 1 cut(s) 631
EcoO65I GGTNACC 1 cut(s) 631
EcoRI GAATTC 1 cut(s) 914
EcoT14I CCWWGG 1 cut(s) 734
ErhI CCWWGG 1 cut(s) 734
Esp3I CGTCTC 1 cut(s) 446
FaeI CATG 5 cut(s) 386, 444, 728, 1103, 1207
FalI AAGNNNNNCTT 2 cut(s) 690, 722
FatI CATG 5 cut(s) 382, 440, 724, 1099, 1203
FauI CCCGC 1 cut(s) 358
FbaI TGATCA 2 cut(s) 873, 1147
Fnu4HI GCNGC 3 cut(s) 405, 513, 1096
FokI GGATG 5 cut(s) 174, 286, 689, 972, 1205
Fsp4HI GCNGC 3 cut(s) 405, 513, 1096
FspAI RTGCGCAY 1 cut(s) 723
FspBI CTAG 2 cut(s) 270, 686
FspI TGCGCA 1 cut(s) 723
GlaI GCGC 1 cut(s) 723
GluI GCNGC 3 cut(s) 405, 513, 1096
HaeIII GGCC 1 cut(s) 1212
HhaI GCGC 1 cut(s) 724
Hin1II CATG 5 cut(s) 386, 444, 728, 1103, 1207
Hin6I GCGC 1 cut(s) 722
HinP1I GCGC 1 cut(s) 722
HindIII AAGCTT 2 cut(s) 38, 525
HinfI GANTC 2 cut(s) 27, 90
HphI GGTGA 5 cut(s) 625, 632, 883, 986, 1045
Hpy166II GTNNAC 1 cut(s) 1170
Hpy188I TCNGA 4 cut(s) 108, 129, 959, 1189
Hpy188III TCNNGA 8 cut(s) 24, 383, 506, 882, 941, 968, 1145, 1251
Hpy8I GTNNAC 1 cut(s) 1170
HpyAV CCTTC 3 cut(s) 649, 928, 1076
HpyCH4IV ACGT 1 cut(s) 455
HpyCH4V TGCA 7 cut(s) 223, 440, 515, 533, 567, 583, 1103
HpyF10VI GCNNNNNNNGC 3 cut(s) 518, 580, 824
HpyF3I CTNAG 2 cut(s) 126, 952
HpySE526I ACGT 1 cut(s) 455
Hsp92II CATG 5 cut(s) 386, 444, 728, 1103, 1207
HspAI GCGC 1 cut(s) 722
Ksp22I TGATCA 2 cut(s) 873, 1147
Kzo9I GATC 4 cut(s) 103, 502, 873, 1147
LmnI GCTCC 1 cut(s) 487
LpnPI CCDG 4 cut(s) 9, 144, 867, 1158
Lsp1109I GCAGC 2 cut(s) 416, 499
LweI GCATC 4 cut(s) 152, 256, 499, 531
MaeI CTAG 2 cut(s) 270, 686
MaeII ACGT 1 cut(s) 455
MaeIII GTNAC 2 cut(s) 631, 840
MalI GATC 4 cut(s) 105, 504, 875, 1149
MboI GATC 4 cut(s) 103, 502, 873, 1147
MboII GAAGA 6 cut(s) 87, 110, 680, 855, 923, 1048
MfeI CAATTG 1 cut(s) 224
MlsI TGGCCA 1 cut(s) 1212
MluCI AATT 8 cut(s) 5, 112, 140, 224, 761, 914, 921, 1140
MluNI TGGCCA 1 cut(s) 1212
MmeI TCCRAC 1 cut(s) 937
MnlI CCTC 8 cut(s) 73, 123, 214, 457, 610, 664, 667, 808
Mox20I TGGCCA 1 cut(s) 1212
MscI TGGCCA 1 cut(s) 1212
MseI TTAA 7 cut(s) 53, 170, 372, 594, 740, 1002, 1160
MslI CAYNNNNRTG 1 cut(s) 381
Msp20I TGGCCA 1 cut(s) 1212
MunI CAATTG 1 cut(s) 224
MwoI GCNNNNNNNGC 3 cut(s) 518, 580, 824
NdeII GATC 4 cut(s) 103, 502, 873, 1147
NlaIII CATG 5 cut(s) 386, 444, 728, 1103, 1207
NlaIV GGNNCC 1 cut(s) 483
NmuCI GTSAC 1 cut(s) 631
NsbI TGCGCA 1 cut(s) 723
NspI RCATGY 1 cut(s) 1207
PagI TCATGA 1 cut(s) 382
PciI ACATGT 1 cut(s) 1203
PfeI GAWTC 2 cut(s) 27, 90
PkrI GCNGC 3 cut(s) 406, 514, 1097
PscI ACATGT 1 cut(s) 1203
PspEI GGTNACC 1 cut(s) 631
PspN4I GGNNCC 1 cut(s) 483
RsaI GTAC 1 cut(s) 12
RsaNI GTAC 1 cut(s) 11
RseI CAYNNNNRTG 1 cut(s) 381
SaqAI TTAA 7 cut(s) 53, 170, 372, 594, 740, 1002, 1160
SatI GCNGC 3 cut(s) 405, 513, 1096
Sau3AI GATC 4 cut(s) 103, 502, 873, 1147
SfaNI GCATC 4 cut(s) 152, 256, 499, 531
SmiMI CAYNNNNRTG 1 cut(s) 381
Sse9I AATT 8 cut(s) 5, 112, 140, 224, 761, 914, 921, 1140
SsiI CCGC 3 cut(s) 365, 799, 1096
SspI AATATT 2 cut(s) 253, 889
SspMI CTAG 2 cut(s) 270, 686
StyI CCWWGG 1 cut(s) 734
TaiI ACGT 1 cut(s) 458
TaqI TCGA 2 cut(s) 48, 615
TasI AATT 8 cut(s) 5, 112, 140, 224, 761, 914, 921, 1140
TauI GCSGC 1 cut(s) 1098
TfiI GAWTC 2 cut(s) 27, 90
Tru1I TTAA 7 cut(s) 53, 170, 372, 594, 740, 1002, 1160
Tru9I TTAA 7 cut(s) 53, 170, 372, 594, 740, 1002, 1160
TseFI GTSAC 1 cut(s) 631
TseI GCWGC 2 cut(s) 404, 512
Tsp45I GTSAC 1 cut(s) 631
TspDTI ATGAA 5 cut(s) 33, 351, 671, 681, 1142
XapI RAATTY 3 cut(s) 914, 921, 1140
XceI RCATGY 1 cut(s) 1207
XspI CTAG 2 cut(s) 270, 686
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.