Rmu_sc0005757.1_g000002

FAR1-related protein

Design Primers CRISPR Design

Basic Information

Type: gene
Biological Identity
rosa_multiflora
Rmu_sc0005757.1
OG0000414
Physical Location & Seq
Reverse (-)
13233 .. 14862
1630 bp
Loading structure...
UTR
Exon/CDS
Intron
Rmu_sc0005757.1_g000002.1.cds

Sequence Viewer

Length: 1236 bp
atgatcattgattatggccaatttggggatgttgttagttttgatacgacatacaagattaacaaatctaatcgacctcttgctgtgttcgttggattcaatcaccaccgtgagactattatatttggggtggctttaatgtatgatgaaacagcagattcatttatatggttgtttgagacttttttgagggcaatgtctgggaaggctctaaagacaatatttacagatgaagatgctacaatggcaaaggctcttcgacatgttatgccagatgcatatcataggctgtgcaaatggcatatgatgcaaaatgccataaagcatgggagtagttttttgacagaggatggtggaatcacaagtattttgtcaaggttcatggaaaatattgaggaggaagatgagtttatatctgcttgggatgctatgcttgatcaatatggtgcgcgtgacaatacttggctgagtagcatatatgatttaagagaaaagtggggctttccgttgcctattctgaaaatgcatgtcaaaatgctatatgaagcaagaaaagtttacactaaactaatatttgaagagtttcaagatcaatttgaatcgtctcttgaagcttctataacagattgtgttgatgttgatggtggaaagatatatactgtgattagagatggctactctagagaacggcaagtgaagagagatagtgatgatatactctcttgtagttgcagattatttgagatgaaaggggttgtatgtaggcacattatcaaggtccttagagaagtgatgcaaatcaaagaaattcctgagcattatatcttaaaaggatggaccaaaaaggctcgagctaaaagtgttcaagacatgcatgagcgtgaaattcaaccagaccctaagttgcaacaagcctcttggtacagggcttctgaaaatgaaaaagcatacaaattagtcatgacaaatgcagagaagttagcaaaagaagttgaagaattgctacgatctgaaatgaatgctaatgtggatgagaatggtcatacaactcaatccactcctggacaactcaatgtagatggtaatgtggttactcctgatcaaatgaatggtgtatacaaggtgacttttgatccaacatgtaatgaagagaatactacgcttgatctaacaaacaatgcagatcaatttctggaacaagacttttgtgcatcttcacttagtcaggtatattaa
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families
FAR1 MULE SWIM

Protein Analysis

411

Amino Acids

47.49

Weight (kDa)

5.13

Isoelectric Point (pI)

38.94

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready
iTOL Interactive Tree Of Life · Most popular EvolView Flexible annotations MEGA Desktop phylogenetics suite FigTree Desktop tree editor

Orthologous Genes (Group: OG0000414)

Species Orthologous Gene IDs
fragaria_vesca FvH4_1g15941 FvH4_1g22181 FvH4_3g31442 FvH4_4g06832 FvH4_5g15722 FvH4_6g30661 FvH4_7g13761
rosa_chinensis RchiOBHm_Chr3g0478271 RchiOBHm_Chr4g0421141
rosa_laevigata RLG00000002038 RLG00000016047 RLG00000021902 RLG00000024696 RLG00000027779 RLG00000033727 RLG00000035621
rosa_multiflora Rmu_sc0000125.1_g000007 Rmu_sc0000221.1_g000019 Rmu_sc0000221.1_g000020 Rmu_sc0000338.1_g000006 Rmu_sc0000429.1_g000059 Rmu_sc0000429.1_g000060 Rmu_sc0000429.1_g000061 Rmu_sc0000543.1_g000046 Rmu_sc0000689.1_g000008 Rmu_sc0000689.1_g000009 Rmu_sc0001436.1_g000002 Rmu_sc0001634.1_g000004 Rmu_sc0001782.1_g000025 Rmu_sc0002206.1_g000012 Rmu_sc0002985.1_g000008 Rmu_sc0002985.1_g000009 Rmu_sc0003044.1_g000040 Rmu_sc0003044.1_g000041 Rmu_sc0003044.1_g000042 Rmu_sc0003275.1_g000010 Rmu_sc0003561.1_g000002 Rmu_sc0003850.1_g000001 Rmu_sc0003850.1_g000002 Rmu_sc0004092.1_g000039 Rmu_sc0004311.1_g000003 Rmu_sc0004443.1_g000016 Rmu_sc0004542.1_g000002 Rmu_sc0004873.1_g000001 Rmu_sc0005757.1_g000002 Rmu_sc0005964.1_g000004 Rmu_sc0006598.1_g000014 Rmu_sc0006598.1_g000015 Rmu_sc0006889.1_g000023 Rmu_sc0007059.1_g000007 Rmu_sc0007390.1_g000014 Rmu_sc0008085.1_g000015 Rmu_sc0009948.1_g000001 Rmu_sc0010235.1_g000005 Rmu_sc0010665.1_g000022 Rmu_sc0011183.1_g000001 Rmu_sc0021637.1_g000001 Rmu_ssc0000242.1_g000016 Rmu_ssc0000317.1_g000003 Rmu_ssc0000317.1_g000004 Rmu_ssc0000432.1_g000093 Rmu_ssc0000432.1_g000095
rosa_roxburghii Rroxscaffold_1G00024670 Rroxscaffold_1G00047120 Rroxscaffold_4G00283230 Rroxscaffold_5G00365300 Rroxscaffold_7G00192220
rosa_rugosa Rorug03G0325200 Rorug06G0093800 Rorug07G0209800
rosa_samantha Rh1AG084000 Rh1AG202300 Rh1AG294200 Rh1BG259000 Rh2AG357500 Rh2AG389500 Rh2CG376700 Rh2CG468700 Rh2DG441200 Rh2DG504700 Rh2DG505700 Rh3BG359700 Rh3DG120200 Rh4BG161300 Rh4CG087000 Rh5BG550100 Rh5CG573000 Rh6AG284900 Rh6AG426700 Rh7DG285400
rosa_wichuraiana Rw1G030090 Rw2G030600 Rw3G018220 Rw3G027930 Rw4G000900 Rw6G003680 Rw6G036920 Rw6G043190 Rw7G020880

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AccI GTMKAC 1 cut(s) 1116
AccII CGCG 1 cut(s) 451
AclWI GGATC 1 cut(s) 1127
AcoI YGGCCR 1 cut(s) 16
AcsI RAATTY 2 cut(s) 807, 885
AfaI GTAC 1 cut(s) 923
AfiI CCNNNNNNNGG 1 cut(s) 25
AflIII ACRYGT 2 cut(s) 262, 1139
AgsI TTSAA 8 cut(s) 100, 578, 587, 599, 611, 866, 890, 995
AjnI CCWGG 1 cut(s) 1060
AleI CACNNNNGTG 1 cut(s) 108
AluBI AGCT 2 cut(s) 614, 854
AluI AGCT 2 cut(s) 614, 854
Alw26I GTCTC 3 cut(s) 107, 173, 609
AlwI GGATC 1 cut(s) 1127
Ama87I CYCGRG 1 cut(s) 849
AoxI GGCC 1 cut(s) 16
ApoI RAATTY 2 cut(s) 807, 885
Asp700I GAANNNNTTC 1 cut(s) 582
AspLEI GCGC 1 cut(s) 451
AspS9I GGNCC 2 cut(s) 778, 837
AsuHPI GGTGA 2 cut(s) 95, 1135
AvaI CYCGRG 1 cut(s) 849
AvaII GGWCC 2 cut(s) 778, 837
BalI TGGCCA 1 cut(s) 18
BarI GAAGNNNNNNTAC 2 cut(s) 987, 1019
BccI CCATC 5 cut(s) 344, 635, 665, 828, 1073
BceAI ACGGC 1 cut(s) 704
BciT130I CCWGG 1 cut(s) 1062
BclI TGATCA 3 cut(s) 3, 436, 1099
BcoDI GTCTC 3 cut(s) 107, 173, 609
BfaI CTAG 1 cut(s) 681
Bme1390I CCNGG 1 cut(s) 1062
Bme18I GGWCC 2 cut(s) 778, 837
BmeT110I CYCGRG 1 cut(s) 849
BmgT120I GGNCC 2 cut(s) 778, 837
BmrFI CCNGG 1 cut(s) 1062
BmsI GCATC 6 cut(s) 226, 265, 297, 415, 783, 1220
Bpu10I CCTNAGC 1 cut(s) 813
BsaBI GATNNNNATC 2 cut(s) 279, 797
Bsc4I CCNNNNNNNGG 1 cut(s) 25
Bse3DI GCAATG 1 cut(s) 201
Bse8I GATNNNNATC 2 cut(s) 279, 797
BseBI CCWGG 1 cut(s) 1062
BseGI GGATG 5 cut(s) 34, 355, 430, 839, 1036
BseJI GATNNNNATC 2 cut(s) 279, 797
BseLI CCNNNNNNNGG 1 cut(s) 25
BseMI GCAATG 1 cut(s) 201
BseMII CTCAG 2 cut(s) 458, 804
BseRI GAGGAG 1 cut(s) 410
Bsh1236I CGCG 1 cut(s) 451
BshFI GGCC 1 cut(s) 18
BsiHKCI CYCGRG 1 cut(s) 849
BslI CCNNNNNNNGG 1 cut(s) 25
BsmAI GTCTC 3 cut(s) 107, 173, 609
BsmBI CGTCTC 1 cut(s) 609
BsmI GAATGC 1 cut(s) 1024
BsnI GGCC 1 cut(s) 18
BsoBI CYCGRG 1 cut(s) 849
Bsp143I GATC 8 cut(s) 3, 436, 589, 1007, 1099, 1132, 1165, 1183
BspANI GGCC 1 cut(s) 18
BspCNI CTCAG 2 cut(s) 459, 805
BspFNI CGCG 1 cut(s) 451
BspHI TCATGA 1 cut(s) 960
BspPI GGATC 1 cut(s) 1127
BspQI GCTCTTC 1 cut(s) 261
BsrDI GCAATG 1 cut(s) 201
BssMI GATC 8 cut(s) 3, 436, 589, 1007, 1099, 1132, 1165, 1183
BssNAI GTATAC 1 cut(s) 1117
Bst1107I GTATAC 1 cut(s) 1117
Bst2UI CCWGG 1 cut(s) 1062
Bst4CI ACNGT 2 cut(s) 110, 661
Bst6I CTCTTC 4 cut(s) 261, 573, 692, 1143
BstAPI GCANNNNNTGC 1 cut(s) 307
BstDEI CTNAG 5 cut(s) 467, 782, 813, 900, 1220
BstF5I GGATG 5 cut(s) 34, 355, 430, 839, 1036
BstFNI CGCG 1 cut(s) 451
BstHHI GCGC 1 cut(s) 451
BstKTI GATC 8 cut(s) 6, 439, 592, 1010, 1102, 1135, 1168, 1186
BstMAI GTCTC 3 cut(s) 107, 173, 609
BstMBI GATC 8 cut(s) 3, 436, 589, 1007, 1099, 1132, 1165, 1183
BstMWI GCNNNNNNNGC 3 cut(s) 245, 307, 425
BstNI CCWGG 1 cut(s) 1062
BstNSI RCATGY 4 cut(s) 266, 530, 874, 1143
BstSCI CCNGG 1 cut(s) 1060
BstUI CGCG 1 cut(s) 451
BstZ17I GTATAC 1 cut(s) 1117
BsuRI GGCC 1 cut(s) 18
BtsCI GGATG 5 cut(s) 34, 355, 430, 839, 1036
CciI TCATGA 1 cut(s) 960
CfoI GCGC 1 cut(s) 451
Cfr13I GGNCC 2 cut(s) 778, 837
Csp6I GTAC 1 cut(s) 922
CviAII CATG 8 cut(s) 263, 326, 382, 527, 871, 875, 961, 1140
CviQI GTAC 1 cut(s) 922
DdeI CTNAG 5 cut(s) 467, 782, 813, 900, 1220
DpnI GATC 8 cut(s) 5, 438, 591, 1009, 1101, 1134, 1167, 1185
DpnII GATC 8 cut(s) 3, 436, 589, 1007, 1099, 1132, 1165, 1183
EaeI YGGCCR 1 cut(s) 16
Eam1104I CTCTTC 4 cut(s) 261, 573, 692, 1143
EarI CTCTTC 4 cut(s) 261, 573, 692, 1143
Eco47I GGWCC 2 cut(s) 778, 837
Eco88I CYCGRG 1 cut(s) 849
EcoO109I RGGNCCY 1 cut(s) 778
EcoRII CCWGG 1 cut(s) 1060
EcoT22I ATGCAT 3 cut(s) 280, 528, 876
Esp3I CGTCTC 1 cut(s) 609
FaeI CATG 8 cut(s) 266, 329, 385, 530, 874, 878, 964, 1143
FalI AAGNNNNNCTT 2 cut(s) 485, 517
FatI CATG 8 cut(s) 262, 325, 381, 526, 870, 874, 960, 1139
FauNDI CATATG 1 cut(s) 303
FbaI TGATCA 3 cut(s) 3, 436, 1099
FblI GTMKAC 1 cut(s) 1116
FokI GGATG 5 cut(s) 41, 362, 437, 846, 1043
FspBI CTAG 1 cut(s) 681
GlaI GCGC 1 cut(s) 450
HaeIII GGCC 1 cut(s) 18
HhaI GCGC 1 cut(s) 451
Hin1II CATG 8 cut(s) 266, 329, 385, 530, 874, 878, 964, 1143
Hin6I GCGC 1 cut(s) 449
HinP1I GCGC 1 cut(s) 449
HindIII AAGCTT 1 cut(s) 612
HinfI GANTC 4 cut(s) 96, 158, 357, 599
HphI GGTGA 2 cut(s) 95, 1135
Hpy166II GTNNAC 2 cut(s) 559, 1117
Hpy188I TCNGA 3 cut(s) 519, 934, 1012
Hpy188III TCNNGA 8 cut(s) 587, 608, 681, 812, 866, 961, 1097, 1193
Hpy8I GTNNAC 2 cut(s) 559, 1117
HpyAV CCTTC 1 cut(s) 199
HpyCH4III ACNGT 2 cut(s) 110, 661
HpyF10VI GCNNNNNNNGC 3 cut(s) 245, 307, 425
HpyF3I CTNAG 5 cut(s) 467, 782, 813, 900, 1220
Hsp92II CATG 8 cut(s) 266, 329, 385, 530, 874, 878, 964, 1143
HspAI GCGC 1 cut(s) 449
Ksp22I TGATCA 3 cut(s) 3, 436, 1099
Kzo9I GATC 8 cut(s) 3, 436, 589, 1007, 1099, 1132, 1165, 1183
LguI GCTCTTC 1 cut(s) 261
LweI GCATC 6 cut(s) 226, 265, 297, 415, 783, 1220
MaeI CTAG 1 cut(s) 681
MaeIII GTNAC 3 cut(s) 452, 1090, 1123
MalI GATC 8 cut(s) 5, 438, 591, 1009, 1101, 1134, 1167, 1185
MboI GATC 8 cut(s) 3, 436, 589, 1007, 1099, 1132, 1165, 1183
MboII GAAGA 8 cut(s) 245, 248, 413, 590, 709, 1007, 1160, 1206
MlsI TGGCCA 1 cut(s) 18
MluCI AATT 7 cut(s) 20, 593, 807, 885, 953, 998, 1187
MluNI TGGCCA 1 cut(s) 18
MmeI TCCRAC 2 cut(s) 73, 1160
MnlI CCTC 6 cut(s) 87, 183, 340, 388, 391, 925
Mox20I TGGCCA 1 cut(s) 18
Mph1103I ATGCAT 3 cut(s) 280, 528, 876
MroXI GAANNNNTTC 1 cut(s) 582
MscI TGGCCA 1 cut(s) 18
MseI TTAA 5 cut(s) 60, 137, 485, 827, 1234
MslI CAYNNNNRTG 3 cut(s) 108, 166, 879
Msp20I TGGCCA 1 cut(s) 18
MspR9I CCNGG 1 cut(s) 1062
Mva1269I GAATGC 1 cut(s) 1024
MvaI CCWGG 1 cut(s) 1062
MvnI CGCG 1 cut(s) 451
MwoI GCNNNNNNNGC 3 cut(s) 245, 307, 425
NdeI CATATG 1 cut(s) 303
NdeII GATC 8 cut(s) 3, 436, 589, 1007, 1099, 1132, 1165, 1183
NlaIII CATG 8 cut(s) 266, 329, 385, 530, 874, 878, 964, 1143
NmuCI GTSAC 2 cut(s) 452, 1123
NsiI ATGCAT 3 cut(s) 280, 528, 876
NspI RCATGY 4 cut(s) 266, 530, 874, 1143
OliI CACNNNNGTG 1 cut(s) 108
PaeR7I CTCGAG 1 cut(s) 849
PagI TCATGA 1 cut(s) 960
PciI ACATGT 2 cut(s) 262, 1139
PciSI GCTCTTC 1 cut(s) 261
PctI GAATGC 1 cut(s) 1024
PdmI GAANNNNTTC 1 cut(s) 582
PfeI GAWTC 4 cut(s) 96, 158, 357, 599
PfoI TCCNGGA 1 cut(s) 1060
PpuMI RGGWCCY 1 cut(s) 778
PscI ACATGT 2 cut(s) 262, 1139
Psp5II RGGWCCY 1 cut(s) 778
Psp6I CCWGG 1 cut(s) 1060
PspGI CCWGG 1 cut(s) 1060
PspPI GGNCC 2 cut(s) 778, 837
PspPPI RGGWCCY 1 cut(s) 778
PspXI VCTCGAGB 1 cut(s) 849
RsaI GTAC 1 cut(s) 923
RsaNI GTAC 1 cut(s) 922
RseI CAYNNNNRTG 3 cut(s) 108, 166, 879
SapI GCTCTTC 1 cut(s) 261
SaqAI TTAA 5 cut(s) 60, 137, 485, 827, 1234
Sau3AI GATC 8 cut(s) 3, 436, 589, 1007, 1099, 1132, 1165, 1183
Sau96I GGNCC 2 cut(s) 778, 837
ScrFI CCNGG 1 cut(s) 1062
SetI ASST 7 cut(s) 79, 380, 616, 780, 856, 1125, 1230
SfaNI GCATC 6 cut(s) 226, 265, 297, 415, 783, 1220
Sfr274I CTCGAG 1 cut(s) 849
SinI GGWCC 2 cut(s) 778, 837
SlaI CTCGAG 1 cut(s) 849
SmiMI CAYNNNNRTG 3 cut(s) 108, 166, 879
SmlI CTYRAG 1 cut(s) 849
SmoI CTYRAG 1 cut(s) 849
Sse9I AATT 7 cut(s) 20, 593, 807, 885, 953, 998, 1187
SspI AATATT 3 cut(s) 222, 391, 573
SspMI CTAG 1 cut(s) 681
StyD4I CCNGG 1 cut(s) 1060
TaaI ACNGT 2 cut(s) 110, 661
TaqI TCGA 3 cut(s) 73, 259, 850
TasI AATT 7 cut(s) 20, 593, 807, 885, 953, 998, 1187
TfiI GAWTC 4 cut(s) 96, 158, 357, 599
Tru1I TTAA 5 cut(s) 60, 137, 485, 827, 1234
Tru9I TTAA 5 cut(s) 60, 137, 485, 827, 1234
TseFI GTSAC 2 cut(s) 452, 1123
Tsp45I GTSAC 2 cut(s) 452, 1123
TspGWI ACGGA 1 cut(s) 495
VpaK11BI GGWCC 2 cut(s) 778, 837
XapI RAATTY 2 cut(s) 807, 885
XbaI TCTAGA 1 cut(s) 680
XceI RCATGY 4 cut(s) 266, 530, 874, 1143
XhoI CTCGAG 1 cut(s) 849
XmiI GTMKAC 1 cut(s) 1116
XmnI GAANNNNTTC 1 cut(s) 582
XspI CTAG 1 cut(s) 681
Zsp2I ATGCAT 3 cut(s) 280, 528, 876
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.