Basic Information

Type: gene

Biological Identity

Species

rosa_multiflora

Chromosome

Rmu_sc0006806.1

Orthogroup ID

OG0000219

Physical Location & Seq

Genomic Coordinates Forward (+)

63861 .. 64166

Gene Structure 306 bp

Loading structure...

UTR

Exon/CDS

Intron

Transcript / Protein ID

Rmu_sc0006806.1_g000027.1.cds

Sequence Viewer

CDS Protein Promoter (2k)

Length: 306 bp

atggctaaatctaatgtagaggatgccatctcttgtttgaagaaattgattgaagctctagagattgcgaaggaggaggcaagagtgaaggctgaggaagaagcaagcaagaaggcagttaacgatgcaaaagtgaacgcaaagaaagaagcaaaattgaaggcagaggaagaagcaaaattgaaggcagagaaagcagagaagaaaactgaggagtctgctaaagatgaagacatatgtatcggaacatcagctaaacaagatgcaaaagaaaatggagttattgaaaatgaggaaaagagttga

Functional Annotation

Gene Ontology

Molecular Function
Biological Process
Cellular Component

GO:0003674 GO:0005215 GO:0005575 GO:0005622 GO:0005623 GO:0005737 GO:0005739 GO:0006810 GO:0008104 GO:0008150 GO:0008320 GO:0008565 GO:0009987 GO:0015031 GO:0015833 GO:0016043 GO:0022607 GO:0022857 GO:0022884 GO:0033036 GO:0034622 GO:0042886 GO:0042887 GO:0043226 GO:0043227 GO:0043229 GO:0043231 GO:0043933 GO:0044085 GO:0044424 GO:0044444 GO:0044464 GO:0045184 GO:0051131 GO:0051179 GO:0051234 GO:0055085 GO:0065003 GO:0071702 GO:0071705 GO:0071806 GO:0071840 GO:1904680

KEGG Pathways

Metabolic & Signaling

No pathways identified.

Pfam Domains

Protein Families

AAA AAA_assoc

Protein Analysis

101

Amino Acids

11.05

Weight (kDa)

5.13

Isoelectric Point (pI)

52.84

Instability Index

Protein Domains (Pfam)

No Pfam domains detected for this protein.

Hydrophobicity Profile (Kyte-Doolittle)

AI Structure Prediction Report

Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter

Style Settings

Font Size (px)

Line Width

Align Labels (Cladogram)

Image

Tree File

Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

iTOL Interactive Tree Of Life · Most popular EvolView Flexible annotations MEGA Desktop phylogenetics suite FigTree Desktop tree editor

Orthologous Genes (Group: OG0000219)

Species	Orthologous Gene IDs
arabidopsis_thaliana	AT3G28580 AT3G28580 AT5G40010
fragaria_vesca	FvH4_5g15870 FvH4_6g49542 FvH4_6g49550 FvH4_6g49560 FvH4_6g49580
malus_domestica	MD09G1043700.v1.1 MD09G1043800.v1.1 MD09G1043900.v1.1 MD14G1190900.v1.1 MD17G1045300.v1.1 MD17G1045500.v1.1 MD17G1045600.v1.1
prunus_persica	Prupe.3G273800_v2.0.a1 Prupe.3G273900_v2.0.a1 Prupe.3G274100_v2.0.a1 Prupe.3G274200_v2.0.a1 Prupe.3G274300_v2.0.a1 Prupe.5G183800_v2.0.a1
pyrus_communis	pycom111g03400 pycom111g03410 pycom14g15860 pycom17g04010 pycom17g04040 pycom17g04070 pycom17g04080
rosa_chinensis	RchiOBHm_Chr2g0169521 RchiOBHm_Chr2g0169541 RchiOBHm_Chr2g0169551 RchiOBHm_Chr2g0169571 RchiOBHm_Chr2g0169581 RchiOBHm_Chr2g0169591 RchiOBHm_Chr2g0170131 RchiOBHm_Chr7g0180181
rosa_laevigata	RLG00000005284 RLG00000021869 RLG00000021870 RLG00000021871 RLG00000021872 RLG00000021873 RLG00000021878 RLG00000021879 RLG00000021880 RLG00000021881 RLG00000021882 RLG00000021883 RLG00000021884 RLG00000021885 RLG00000021886 RLG00000021926 RLG00000021927
rosa_multiflora	Rmu_co8112588.1_g000001 Rmu_co8118398.1_g000001 Rmu_co8187516.1_g000001 Rmu_co8476833.1_g000001 Rmu_sc0006806.1_g000003 Rmu_sc0006806.1_g000004 Rmu_sc0006806.1_g000005 Rmu_sc0006806.1_g000007 Rmu_sc0006806.1_g000008 Rmu_sc0006806.1_g000009 Rmu_sc0006806.1_g000010 Rmu_sc0006806.1_g000011 Rmu_sc0006806.1_g000012 Rmu_sc0006806.1_g000013 Rmu_sc0006806.1_g000026 Rmu_sc0006806.1_g000027 Rmu_sc0011963.1_g000001 Rmu_sc0013078.1_g000004 Rmu_sc0019635.1_g000002 Rmu_sc0019635.1_g000003 Rmu_sc0019635.1_g000004 Rmu_sc0019635.1_g000005 Rmu_sc0019635.1_g000006 Rmu_sc0019635.1_g000007 Rmu_sc0019635.1_g000008 Rmu_sc0019635.1_g000009
rosa_roxburghii	Rroxscaffold_2G00081990 Rroxscaffold_2G00082000 Rroxscaffold_2G00082010 Rroxscaffold_2G00082020 Rroxscaffold_2G00082030 Rroxscaffold_2G00082040 Rroxscaffold_2G00082050 Rroxscaffold_3G00273050
rosa_rugosa	Rorug02G0540500 Rorug02G0540600 Rorug02G0540700 Rorug02G0540800 Rorug02G0540900 Rorug02G0541000 Rorug02G0541100 Rorug02G0541100 Rorug02G0541200 Rorug02G0541300 Rorug02G0546000.1 Rorug06G0431600
rosa_samantha	Rh2AG611900 Rh2AG612000 Rh2AG612100 Rh2AG612200 Rh2AG613000 Rh2AG613100 Rh2AG613200 Rh2AG613300 Rh2AG613400 Rh2AG613500 Rh2AG613600 Rh2AG613700 Rh2AG618200 Rh2BG625700 Rh2BG625800 Rh2BG625900 Rh2CG593800 Rh2CG593900 Rh2CG594300 Rh2CG594400 Rh2CG594500 Rh2CG594600 Rh2CG594800 Rh2CG594900 Rh2CG595000 Rh2CG595100 Rh2CG599000 Rh2DG636100 Rh2DG636200 Rh2DG636300 Rh2DG636400 Rh2DG636500 Rh2DG636600 Rh2DG636700 Rh2DG636800 Rh2DG636900 Rh2DG641400 Rh7AG031800 Rh7BG031800
rosa_wichuraiana	Rw2G050750 Rw2G050790 Rw2G050820 Rw2G050830 Rw2G050840 Rw2G050850 Rw2G050860 Rw2G051180 Rw7G002650

Restriction Enzyme Sites

1 / 10

Enzyme	Recognition Site	Cut Count	Positions (bp)
AgsI	TTSAA	5 cut(s)	40, 53, 160, 184, 287
AluBI	AGCT	2 cut(s)	56, 254
AluI	AGCT	2 cut(s)	56, 254
BaeI	ACNNNNGTAYC	2 cut(s)	223, 256
BbsI	GAAGAC	1 cut(s)	237
BbvCI	CCTCAGC	1 cut(s)	93
BccI	CCATC	1 cut(s)	35
BfaI	CTAG	1 cut(s)	59
BmsI	GCATC	3 cut(s)	13, 115, 253
BpiI	GAAGAC	1 cut(s)	237
Bpu10I	CCTNAGC	1 cut(s)	93
BseGI	GGATG	1 cut(s)	28
BseMII	CTCAG	2 cut(s)	84, 201
BseRI	GAGGAG	2 cut(s)	89, 227
BspCNI	CTCAG	2 cut(s)	85, 202
BstC8I	GCNNGC	1 cut(s)	106
BstDEI	CTNAG	2 cut(s)	93, 210
BstF5I	GGATG	1 cut(s)	28
BstMWI	GCNNNNNNNGC	1 cut(s)	194
BstV2I	GAAGAC	1 cut(s)	237
BtsCI	GGATG	1 cut(s)	28
Cac8I	GCNNGC	1 cut(s)	106
CviJI	RGCY	4 cut(s)	5, 56, 92, 254
CviKI_1	RGCY	4 cut(s)	5, 56, 92, 254
DdeI	CTNAG	2 cut(s)	93, 210
FaiI	YATR	2 cut(s)	236, 238
FauNDI	CATATG	1 cut(s)	236
FokI	GGATG	1 cut(s)	35
FspBI	CTAG	1 cut(s)	59
HincII	GTYRAC	1 cut(s)	121
HindII	GTYRAC	1 cut(s)	121
HinfI	GANTC	1 cut(s)	215
HpaI	GTTAAC	1 cut(s)	121
Hpy166II	GTNNAC	2 cut(s)	121, 136
Hpy188I	TCNGA	1 cut(s)	245
Hpy188III	TCNNGA	1 cut(s)	59
Hpy8I	GTNNAC	2 cut(s)	121, 136
HpyAV	CCTTC	5 cut(s)	64, 82, 106, 154, 178
HpyCH4V	TGCA	2 cut(s)	128, 266
HpyF10VI	GCNNNNNNNGC	1 cut(s)	194
HpyF3I	CTNAG	2 cut(s)	93, 210
KspAI	GTTAAC	1 cut(s)	121
LweI	GCATC	3 cut(s)	13, 115, 253
MaeI	CTAG	1 cut(s)	59
MboII	GAAGA	5 cut(s)	52, 110, 182, 214, 242
MluCI	AATT	3 cut(s)	44, 155, 179
MlyI	GAGTC	1 cut(s)	224
MnlI	CCTC	7 cut(s)	13, 67, 70, 88, 160, 205, 286
MseI	TTAA	1 cut(s)	120
MwoI	GCNNNNNNNGC	1 cut(s)	194
NdeI	CATATG	1 cut(s)	236
PleI	GAGTC	1 cut(s)	223
PpsI	GAGTC	1 cut(s)	223
SaqAI	TTAA	1 cut(s)	120
SchI	GAGTC	1 cut(s)	224
SetI	ASST	2 cut(s)	58, 256
SfaNI	GCATC	3 cut(s)	13, 115, 253
SgeI	CNNG	6 cut(s)	45, 71, 93, 117, 121, 272
Sse9I	AATT	3 cut(s)	44, 155, 179
SspMI	CTAG	1 cut(s)	59
TasI	AATT	3 cut(s)	44, 155, 179
Tru1I	TTAA	1 cut(s)	120
Tru9I	TTAA	1 cut(s)	120
TspDTI	ATGAA	1 cut(s)	243
XbaI	TCTAGA	1 cut(s)	58
XspI	CTAG	1 cut(s)	59

Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.