Basic Information

Type: gene

Biological Identity

Species

rosa_multiflora

Chromosome

Rmu_sc0031755.1

Orthogroup ID

OG0000246

Physical Location & Seq

Genomic Coordinates Forward (+)

2634 .. 3756

Gene Structure 1123 bp

Loading structure...

UTR

Exon/CDS

Intron

Transcript / Protein ID

Rmu_sc0031755.1_g000002.1.cds

Sequence Viewer

CDS Protein Promoter (2k)

Length: 1050 bp

atggccaccgtgaaatggtctgatcttcccaaggagctttggcccttcatcggaaaattccttcacagacgcatcgacattctcctatttcgcagctccctatggctttcttctcgccctcttcttctccctgtcagctcctctcctacctccgccaggaaaagaaaaaaggaagccgtacttttcaaaagcacatgcactgtatcgcatggagtccctcatcgacgaagatcgcaatgctgcactatcaaagccttgttcatggttgatgaaaggtatgagttcaatctatttgactttcggcttgtggaattgcgaaagtcatatgttcttaaagataccgagtatgtctgttttcccgttgattccgtgcaaaaagtggtggttatgactgatgagcatttgaacattgataatgtgtatgcggtatttatgatttttcagagagggaatctgggttttgggagggttggagatgagaactcgatcaatgtcgatgaacaaaactcggattatcatgatatgatcatcatttacaagggtcaatgctatgttgttgattattgggggataatttcatgggtcaattcagctttggaggtgattcagttttcgcctccgatatgtgggtctggtgggcagaagcatttggtggaatcttgtggtgatctttacgtggttgttcagtacagtgcaacgttgacttgccagggcaataggagagttaggtactcacaccaagaggatgaatatcctgaagcaattggttttaaagtttataagctggatcaagaatggggtaattataaatgggtcaatgtgaaagacttgggagatcgagtgtttattttaagcaatgataggtctttctctgtctccaccagagagtttgctggagtgaaaggaaattgcattttcttcattgcacaagcatcagcaaggtgttacagttgtgtgttcagtttggaggatggtaggattaggaacctagcatcttcggagtgttctcagatggtccagccaccttcaaatttgctcaaccccaattga

Functional Annotation

Gene Ontology

Molecular Function
Biological Process
Cellular Component

GO:0006109 GO:0008150 GO:0009889 GO:0009890 GO:0009892 GO:0010565 GO:0019222 GO:0030656 GO:0031323 GO:0031324 GO:0031326 GO:0031327 GO:0043255 GO:0045912 GO:0046137 GO:0048519 GO:0048523 GO:0050789 GO:0050794 GO:0051193 GO:0051195 GO:0051196 GO:0051198 GO:0062012 GO:0062014 GO:0065007 GO:0080090 GO:2000082 GO:2000083

KEGG Pathways

Metabolic & Signaling

No pathways identified.

Pfam Domains

Protein Families

DUF295 F-box

Protein Analysis

349

Amino Acids

40.1

Weight (kDa)

8.19

Isoelectric Point (pI)

40.18

Instability Index

Protein Domains (Pfam)

No Pfam domains detected for this protein.

Hydrophobicity Profile (Kyte-Doolittle)

AI Structure Prediction Report

Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter

Style Settings

Font Size (px)

Line Width

Align Labels (Cladogram)

Image

Tree File

Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

iTOL Interactive Tree Of Life · Most popular EvolView Flexible annotations MEGA Desktop phylogenetics suite FigTree Desktop tree editor

Orthologous Genes (Group: OG0000246)

Species	Orthologous Gene IDs
arabidopsis_thaliana	AT1G44080 AT1G57906 AT1G65735 AT1G65740 AT1G65760 AT1G65770 AT2G17690 AT2G26160 AT3G25750 AT3G25750 AT4G35733
fragaria_vesca	FvH4_1g10810 FvH4_1g10830 FvH4_1g10840 FvH4_1g10840 FvH4_1g10840 FvH4_1g10860 FvH4_1g10880
malus_domestica	MD02G1122000.v1.1 MD15G1235700.v1.1 MD15G1235900.v1.1
prunus_persica	Prupe.7G177000_v2.0.a1 Prupe.7G177100_v2.0.a1 Prupe.7G177200_v2.0.a1 Prupe.7G177300_v2.0.a1 Prupe.7G177400_v2.0.a1 Prupe.7G177400_v2.0.a1
pyrus_communis	pycom02g09500 pycom15g20990 pycom15g21000
rosa_chinensis	RchiOBHm_Chr1g0325601 RchiOBHm_Chr2g0098071 RchiOBHm_Chr2g0098081 RchiOBHm_Chr2g0098091 RchiOBHm_Chr2g0098121 RchiOBHm_Chr2g0098131 RchiOBHm_Chr2g0098151 RchiOBHm_Chr2g0134711 RchiOBHm_Chr3g0456141 RchiOBHm_Chr4g0394811 RchiOBHm_Chr4g0416561 RchiOBHm_Chr5g0014321
rosa_laevigata	RLG00000001178 RLG00000016753 RLG00000016754 RLG00000016755 RLG00000016756 RLG00000016757 RLG00000016758 RLG00000016760 RLG00000016761 RLG00000016762 RLG00000016763
rosa_multiflora	Rmu_co8307469.1_g000001 Rmu_sc0000427.1_g000002 Rmu_sc0002880.1_g000004 Rmu_sc0002880.1_g000007 Rmu_sc0009178.1_g000019 Rmu_sc0013919.1_g000002 Rmu_sc0013919.1_g000003 Rmu_sc0014278.1_g000001 Rmu_sc0031755.1_g000001 Rmu_sc0031755.1_g000002 Rmu_sc0039043.1_g000001 Rmu_sc0039432.1_g000001
rosa_roxburghii	Rroxscaffold_2G00144260 Rroxscaffold_2G00144270 Rroxscaffold_2G00144290 Rroxscaffold_2G00144310 Rroxscaffold_2G00144320 Rroxscaffold_2G00144340 Rroxscaffold_3G00238070
rosa_rugosa	Rorug02G0069800 Rorug02G0069900 Rorug02G0070000 Rorug02G0070100 Rorug02G0070200 Rorug02G0070500 Rorug02G0070500 Rorug05G0053500 Rorug05G0482400 Rorug07G0244200
rosa_samantha	Rh1DG210300 Rh2AG117100 Rh2AG117200 Rh2AG117300 Rh2AG117500 Rh2AG117700 Rh2AG117800 Rh2AG563300 Rh2BG119900 Rh2BG120000 Rh2BG120200 Rh2BG120300 Rh2BG120400 Rh2BG120600 Rh2BG120700 Rh2BG377200 Rh2CG076100 Rh2CG076200 Rh2CG121600 Rh2CG121700 Rh2CG121900 Rh2CG122000 Rh2CG122100 Rh2CG122200 Rh2CG122300 Rh2DG121600 Rh2DG121700 Rh2DG122000 Rh2DG122100 Rh2DG122300 Rh3AG138900 Rh3BG074100 Rh3CG073500 Rh3DG298600 Rh4CG222800 Rh4CG222900 Rh5CG120400 Rh6BG018400 Rh6BG124600 Rh6CG123200 Rh6CG123300 Rh7AG342600 Rh7AG342700 Rh7BG352100 Rh7CG128700 Rh7CG360200 Rh7CG360300
rosa_wichuraiana	Rw2G009150 Rw2G009160 Rw2G009170 Rw2G009200 Rw4G016710 Rw5G035380 Rw6G043260

Restriction Enzyme Sites

1 / 10

Enzyme	Recognition Site	Cut Count	Positions (bp)
AanI	TTATAA	2 cut(s)	780, 807
AciI	CCGC	2 cut(s)	153, 425
AclI	AACGTT	1 cut(s)	698
AclWI	GGATC	1 cut(s)	795
AcoI	YGGCCR	1 cut(s)	3
AcsI	RAATTY	2 cut(s)	56, 1030
AcuI	CTGAAG	1 cut(s)	777
AfaI	GTAC	3 cut(s)	180, 689, 731
AfiI	CCNNNNNNNGG	4 cut(s)	15, 50, 156, 626
AgsI	TTSAA	4 cut(s)	187, 286, 406, 1029
AjnI	CCWGG	2 cut(s)	155, 708
AluBI	AGCT	5 cut(s)	37, 96, 138, 593, 784
AluI	AGCT	5 cut(s)	37, 96, 138, 593, 784
Alw26I	GTCTC	1 cut(s)	880
AlwI	GGATC	1 cut(s)	795
AoxI	GGCC	2 cut(s)	3, 41
ApeKI	GCWGC	2 cut(s)	93, 240
ApoI	RAATTY	2 cut(s)	56, 1030
AspS9I	GGNCC	2 cut(s)	42, 1015
AsuHPI	GGTGA	2 cut(s)	613, 677
AvaII	GGWCC	1 cut(s)	1015
BalI	TGGCCA	1 cut(s)	5
BbvI	GCAGC	2 cut(s)	105, 227
BccI	CCATC	2 cut(s)	965, 1006
BceAI	ACGGC	1 cut(s)	161
BciT130I	CCWGG	2 cut(s)	157, 710
BclI	TGATCA	1 cut(s)	525
BcoDI	GTCTC	1 cut(s)	880
BfaI	CTAG	1 cut(s)	989
BisI	GCNGC	2 cut(s)	94, 241
BlsI	GCNGC	2 cut(s)	95, 242
Bme1390I	CCNGG	2 cut(s)	157, 710
Bme18I	GGWCC	1 cut(s)	1015
BmgT120I	GGNCC	2 cut(s)	42, 1015
BmiI	GGNNCC	1 cut(s)	986
BmrFI	CCNGG	2 cut(s)	157, 710
BmsI	GCATC	3 cut(s)	81, 941, 1001
BpmI	CTGGAG	1 cut(s)	915
BsaAI	YACGTR	1 cut(s)	676
BsaBI	GATNNNNATC	1 cut(s)	750
BsaJI	CCNNGG	2 cut(s)	30, 709
BsaXI	ACNNNNNCTCC	2 cut(s)	825, 855
Bsc4I	CCNNNNNNNGG	4 cut(s)	15, 50, 156, 626
Bse3DI	GCAATG	3 cut(s)	242, 862, 921
Bse8I	GATNNNNATC	1 cut(s)	750
BseBI	CCWGG	2 cut(s)	157, 710
BseDI	CCNNGG	2 cut(s)	30, 709
BseGI	GGATG	2 cut(s)	751, 976
BseJI	GATNNNNATC	1 cut(s)	750
BseLI	CCNNNNNNNGG	4 cut(s)	15, 50, 156, 626
BseMI	GCAATG	3 cut(s)	242, 862, 921
BseMII	CTCAG	1 cut(s)	1022
BseRI	GAGGAG	1 cut(s)	130
BseXI	GCAGC	2 cut(s)	105, 227
BsgI	GTGCAG	1 cut(s)	226
BshFI	GGCC	2 cut(s)	5, 43
BslFI	GGGAC	1 cut(s)	200
BslI	CCNNNNNNNGG	4 cut(s)	15, 50, 156, 626
BsmAI	GTCTC	1 cut(s)	880
BsmFI	GGGAC	1 cut(s)	200
BsnI	GGCC	2 cut(s)	5, 43
Bsp143I	GATC	7 cut(s)	22, 230, 486, 525, 667, 787, 835
BspACI	CCGC	2 cut(s)	153, 425
BspANI	GGCC	2 cut(s)	5, 43
BspCNI	CTCAG	1 cut(s)	1021
BspHI	TCATGA	1 cut(s)	517
BspLI	GGNNCC	1 cut(s)	986
BspPI	GGATC	1 cut(s)	795
BsrDI	GCAATG	3 cut(s)	242, 862, 921
BssECI	CCNNGG	2 cut(s)	30, 709
BssMI	GATC	7 cut(s)	22, 230, 486, 525, 667, 787, 835
BssT1I	CCWWGG	1 cut(s)	30
Bst2UI	CCWGG	2 cut(s)	157, 710
Bst4CI	ACNGT	4 cut(s)	10, 202, 692, 950
Bst6I	CTCTTC	1 cut(s)	126
BstBAI	YACGTR	1 cut(s)	676
BstDEI	CTNAG	1 cut(s)	1008
BstENI	CCTNNNNNAGG	1 cut(s)	154
BstF5I	GGATG	2 cut(s)	751, 976
BstKTI	GATC	7 cut(s)	25, 233, 489, 528, 670, 790, 838
BstMAI	GTCTC	1 cut(s)	880
BstMBI	GATC	7 cut(s)	22, 230, 486, 525, 667, 787, 835
BstNI	CCWGG	2 cut(s)	157, 710
BstNSI	RCATGY	1 cut(s)	198
BstSCI	CCNGG	2 cut(s)	155, 708
BstV1I	GCAGC	2 cut(s)	105, 227
BsuRI	GGCC	2 cut(s)	5, 43
BtsCI	GGATG	2 cut(s)	751, 976
BtsIMutI	CAGTG	2 cut(s)	198, 697
CciI	TCATGA	1 cut(s)	517
Cfr13I	GGNCC	2 cut(s)	42, 1015
CseI	GACGC	1 cut(s)	78
Csp6I	GTAC	3 cut(s)	179, 688, 730
CviAII	CATG	5 cut(s)	195, 209, 262, 518, 579
CviQI	GTAC	3 cut(s)	179, 688, 730
DdeI	CTNAG	1 cut(s)	1008
DpnI	GATC	7 cut(s)	24, 232, 488, 527, 669, 789, 837
DpnII	GATC	7 cut(s)	22, 230, 486, 525, 667, 787, 835
DraI	TTTAAA	1 cut(s)	772
EaeI	YGGCCR	1 cut(s)	3
Eam1104I	CTCTTC	1 cut(s)	126
EarI	CTCTTC	1 cut(s)	126
EciI	GGCGGA	1 cut(s)	142
Eco130I	CCWWGG	1 cut(s)	30
Eco47I	GGWCC	1 cut(s)	1015
Eco57I	CTGAAG	1 cut(s)	777
EcoNI	CCTNNNNNAGG	1 cut(s)	154
EcoRII	CCWGG	2 cut(s)	155, 708
EcoT14I	CCWWGG	1 cut(s)	30
ErhI	CCWWGG	1 cut(s)	30
FaeI	CATG	5 cut(s)	198, 212, 265, 521, 582
FalI	AAGNNNNNCTT	2 cut(s)	165, 197
FaqI	GGGAC	1 cut(s)	200
FatI	CATG	5 cut(s)	194, 208, 261, 517, 578
FauNDI	CATATG	1 cut(s)	325
FbaI	TGATCA	1 cut(s)	525
Fnu4HI	GCNGC	2 cut(s)	94, 241
FokI	GGATG	2 cut(s)	758, 983
Fsp4HI	GCNGC	2 cut(s)	94, 241
FspBI	CTAG	1 cut(s)	989
GluI	GCNGC	2 cut(s)	94, 241
GsuI	CTGGAG	1 cut(s)	915
HaeIII	GGCC	2 cut(s)	5, 43
HgaI	GACGC	1 cut(s)	78
Hin1II	CATG	5 cut(s)	198, 212, 265, 521, 582
HincII	GTYRAC	1 cut(s)	702
HindII	GTYRAC	1 cut(s)	702
HinfI	GANTC	5 cut(s)	213, 365, 451, 604, 656
HphI	GGTGA	2 cut(s)	613, 677
Hpy166II	GTNNAC	1 cut(s)	702
Hpy188I	TCNGA	7 cut(s)	22, 53, 444, 511, 621, 1000, 1011
Hpy188III	TCNNGA	3 cut(s)	518, 755, 791
Hpy8I	GTNNAC	1 cut(s)	702
Hpy99I	CGWCG	1 cut(s)	228
HpyAV	CCTTC	3 cut(s)	55, 71, 1035
HpyCH4III	ACNGT	4 cut(s)	10, 202, 692, 950
HpyCH4IV	ACGT	2 cut(s)	675, 698
HpyCH4V	TGCA	6 cut(s)	198, 243, 373, 695, 912, 926
HpyF3I	CTNAG	1 cut(s)	1008
HpySE526I	ACGT	2 cut(s)	675, 698
Hsp92II	CATG	5 cut(s)	198, 212, 265, 521, 582
Ksp22I	TGATCA	1 cut(s)	525
Kzo9I	GATC	7 cut(s)	22, 230, 486, 525, 667, 787, 835
LmnI	GCTCC	3 cut(s)	34, 101, 143
Lsp1109I	GCAGC	2 cut(s)	105, 227
LweI	GCATC	3 cut(s)	81, 941, 1001
MaeI	CTAG	1 cut(s)	989
MaeII	ACGT	2 cut(s)	675, 698
MaeIII	GTNAC	1 cut(s)	944
MalI	GATC	7 cut(s)	24, 232, 488, 527, 669, 789, 837
MboI	GATC	7 cut(s)	22, 230, 486, 525, 667, 787, 835
MboII	GAAGA	7 cut(s)	17, 102, 113, 116, 240, 910, 987
MfeI	CAATTG	2 cut(s)	762, 1045
MlsI	TGGCCA	1 cut(s)	5
MluCI	AATT	9 cut(s)	56, 311, 573, 586, 762, 802, 907, 1030, 1045
MluNI	TGGCCA	1 cut(s)	5
MlyI	GAGTC	1 cut(s)	222
MmeI	TCCRAC	1 cut(s)	451
Mox20I	TGGCCA	1 cut(s)	5
MscI	TGGCCA	1 cut(s)	5
MseI	TTAA	3 cut(s)	333, 771, 851
Msp20I	TGGCCA	1 cut(s)	5
MspR9I	CCNGG	2 cut(s)	157, 710
MunI	CAATTG	2 cut(s)	762, 1045
MvaI	CCWGG	2 cut(s)	157, 710
NdeI	CATATG	1 cut(s)	325
NdeII	GATC	7 cut(s)	22, 230, 486, 525, 667, 787, 835
NlaIII	CATG	5 cut(s)	198, 212, 265, 521, 582
NlaIV	GGNNCC	1 cut(s)	986
NspI	RCATGY	1 cut(s)	198
PagI	TCATGA	1 cut(s)	517
PfeI	GAWTC	4 cut(s)	365, 451, 604, 656
PkrI	GCNGC	2 cut(s)	95, 242
PleI	GAGTC	1 cut(s)	221
PpsI	GAGTC	1 cut(s)	221
Ppu21I	YACGTR	1 cut(s)	676
PsiI	TTATAA	2 cut(s)	780, 807
Psp1406I	AACGTT	1 cut(s)	698
Psp6I	CCWGG	2 cut(s)	155, 708
PspGI	CCWGG	2 cut(s)	155, 708
PspN4I	GGNNCC	1 cut(s)	986
PspPI	GGNCC	2 cut(s)	42, 1015
RsaI	GTAC	3 cut(s)	180, 689, 731
RsaNI	GTAC	3 cut(s)	179, 688, 730
SaqAI	TTAA	3 cut(s)	333, 771, 851
SatI	GCNGC	2 cut(s)	94, 241
Sau3AI	GATC	7 cut(s)	22, 230, 486, 525, 667, 787, 835
Sau96I	GGNCC	2 cut(s)	42, 1015
SchI	GAGTC	1 cut(s)	222
ScrFI	CCNGG	2 cut(s)	157, 710
SfaNI	GCATC	3 cut(s)	81, 941, 1001
SinI	GGWCC	1 cut(s)	1015
Sse9I	AATT	9 cut(s)	56, 311, 573, 586, 762, 802, 907, 1030, 1045
SsiI	CCGC	2 cut(s)	153, 425
SspMI	CTAG	1 cut(s)	989
StyD4I	CCNGG	2 cut(s)	155, 708
StyI	CCWWGG	1 cut(s)	30
TaaI	ACNGT	4 cut(s)	10, 202, 692, 950
TaiI	ACGT	2 cut(s)	678, 701
TaqI	TCGA	5 cut(s)	75, 223, 485, 495, 838
TasI	AATT	9 cut(s)	56, 311, 573, 586, 762, 802, 907, 1030, 1045
TatI	WGTACW	1 cut(s)	687
TfiI	GAWTC	4 cut(s)	365, 451, 604, 656
Tru1I	TTAA	3 cut(s)	333, 771, 851
Tru9I	TTAA	3 cut(s)	333, 771, 851
TscAI	CASTG	2 cut(s)	205, 697
TseI	GCWGC	2 cut(s)	93, 240
TspDTI	ATGAA	7 cut(s)	37, 250, 285, 513, 567, 762, 910
TspGWI	ACGGA	1 cut(s)	358
TspRI	CASTG	2 cut(s)	205, 697
VpaK11BI	GGWCC	1 cut(s)	1015
XagI	CCTNNNNNAGG	1 cut(s)	154
XapI	RAATTY	2 cut(s)	56, 1030
XceI	RCATGY	1 cut(s)	198
XspI	CTAG	1 cut(s)	989

Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.