Rh7CG360300

f-box protein

Basic Information

Type: gene
Biological Identity
rosa_samantha
Chr7C
Physical Location & Seq
Reverse (-)
44720324 .. 44720680
357 bp
Loading structure...
UTR
Exon/CDS
Intron
Rh7CG360300.1

Sequence Viewer

Length: 357 bp
ATGATCAAATTAGGGAAGTCGTATTTTCTGAGATACATCCTTGGCTCTAGTTCTGTTTGTGGTTTAAAGAAAGTGATTTTAATGCCTGCTGAGATTGTCGATTGTGCTATTCTGGTTATCTCTGATAAGGGAAATTTGGGTTTTGCTAAAAGTGGAGATGAGAAACTCACATGGTTTAGTAATGGAGGTTTTGTTTTTGATGATGTTATTGTCTATAAGGGTCAGCCATATGTGGTGGATAGCTTGGGTTATATTTTTAGGATTGATGTGTCTTCAGAAGTGATGGTGAAGATTTCGTCGAAAGTGATTGGTTTTGGTGGGAGGAAGCATTTGGTAGAGTCTTGTGGAGAGCTTTAA

Protein Analysis

118

Amino Acids

12.89

Weight (kDa)

8.42

Isoelectric Point (pI)

24.34

Instability Index
Protein Domains (Pfam)
Domain Name Pfam ID Position E-value Description
Beta-prop_KIB1-4 PF03478 22 - 118 2.6e-11 KIB1-4 beta-propeller
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Orthologous Genes (Group: OG0000246)

Species Orthologous Gene IDs
arabidopsis_thaliana AT1G44080 AT1G57906 AT1G65735 AT1G65740 AT1G65760 AT1G65770 AT2G17690 AT2G26160 AT3G25750 AT3G25750 AT4G35733
fragaria_vesca FvH4_1g10810 FvH4_1g10830 FvH4_1g10840 FvH4_1g10840 FvH4_1g10840 FvH4_1g10860 FvH4_1g10880
malus_domestica MD02G1122000.v1.1 MD15G1235700.v1.1 MD15G1235900.v1.1
prunus_persica Prupe.7G177000_v2.0.a1 Prupe.7G177100_v2.0.a1 Prupe.7G177200_v2.0.a1 Prupe.7G177300_v2.0.a1 Prupe.7G177400_v2.0.a1 Prupe.7G177400_v2.0.a1
pyrus_communis pycom02g09500 pycom15g20990 pycom15g21000
rosa_chinensis RchiOBHm_Chr1g0325601 RchiOBHm_Chr2g0098071 RchiOBHm_Chr2g0098081 RchiOBHm_Chr2g0098091 RchiOBHm_Chr2g0098121 RchiOBHm_Chr2g0098131 RchiOBHm_Chr2g0098151 RchiOBHm_Chr2g0134711 RchiOBHm_Chr3g0456141 RchiOBHm_Chr4g0394811 RchiOBHm_Chr4g0416561 RchiOBHm_Chr5g0014321
rosa_laevigata RLG00000001178 RLG00000016753 RLG00000016754 RLG00000016755 RLG00000016756 RLG00000016757 RLG00000016758 RLG00000016760 RLG00000016761 RLG00000016762 RLG00000016763
rosa_multiflora Rmu_co8307469.1_g000001 Rmu_sc0000427.1_g000002 Rmu_sc0002880.1_g000004 Rmu_sc0002880.1_g000007 Rmu_sc0009178.1_g000019 Rmu_sc0013919.1_g000002 Rmu_sc0013919.1_g000003 Rmu_sc0014278.1_g000001 Rmu_sc0031755.1_g000001 Rmu_sc0031755.1_g000002 Rmu_sc0039043.1_g000001 Rmu_sc0039432.1_g000001
rosa_roxburghii Rroxscaffold_2G00144260 Rroxscaffold_2G00144270 Rroxscaffold_2G00144290 Rroxscaffold_2G00144310 Rroxscaffold_2G00144320 Rroxscaffold_2G00144340 Rroxscaffold_3G00238070
rosa_rugosa Rorug02G0069800 Rorug02G0069900 Rorug02G0070000 Rorug02G0070100 Rorug02G0070200 Rorug02G0070500 Rorug02G0070500 Rorug05G0053500 Rorug05G0482400 Rorug07G0244200
rosa_samantha Rh1DG210300 Rh2AG117100 Rh2AG117200 Rh2AG117300 Rh2AG117500 Rh2AG117700 Rh2AG117800 Rh2AG563300 Rh2BG119900 Rh2BG120000 Rh2BG120200 Rh2BG120300 Rh2BG120400 Rh2BG120600 Rh2BG120700 Rh2BG377200 Rh2CG076100 Rh2CG076200 Rh2CG121600 Rh2CG121700 Rh2CG121900 Rh2CG122000 Rh2CG122100 Rh2CG122200 Rh2CG122300 Rh2DG121600 Rh2DG121700 Rh2DG122000 Rh2DG122100 Rh2DG122300 Rh3AG138900 Rh3BG074100 Rh3CG073500 Rh3DG298600 Rh4CG222800 Rh4CG222900 Rh5CG120400 Rh6BG018400 Rh6BG124600 Rh6CG123200 Rh6CG123300 Rh7AG342600 Rh7AG342700 Rh7BG352100 Rh7CG128700 Rh7CG360200 Rh7CG360300
rosa_wichuraiana Rw2G009150 Rw2G009160 Rw2G009170 Rw2G009200 Rw4G016710 Rw5G035380 Rw6G043260

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AcsI RAATTY 1 cut(s) 133
AcuI CTGAAG 1 cut(s) 258
AluBI AGCT 2 cut(s) 243, 352
AluI AGCT 2 cut(s) 243, 352
ApoI RAATTY 1 cut(s) 133
AsuHPI GGTGA 1 cut(s) 298
BbsI GAAGAC 1 cut(s) 264
BccI CCATC 1 cut(s) 277
BclI TGATCA 1 cut(s) 3
BfaI CTAG 1 cut(s) 48
BpiI GAAGAC 1 cut(s) 264
BsaJI CCNNGG 1 cut(s) 40
BsaXI ACNNNNNCTCC 2 cut(s) 177, 207
BseDI CCNNGG 1 cut(s) 40
BseGI GGATG 1 cut(s) 36
BseMII CTCAG 2 cut(s) 20, 81
Bsp143I GATC 1 cut(s) 3
BspCNI CTCAG 2 cut(s) 21, 82
BssECI CCNNGG 1 cut(s) 40
BssMI GATC 1 cut(s) 3
BssT1I CCWWGG 1 cut(s) 40
BstC8I GCNNGC 1 cut(s) 87
BstDEI CTNAG 2 cut(s) 29, 90
BstF5I GGATG 1 cut(s) 36
BstKTI GATC 1 cut(s) 6
BstMBI GATC 1 cut(s) 3
BstV2I GAAGAC 1 cut(s) 264
BtsCI GGATG 1 cut(s) 36
Cac8I GCNNGC 1 cut(s) 87
CviAII CATG 1 cut(s) 171
CviJI RGCY 4 cut(s) 45, 226, 243, 352
CviKI_1 RGCY 4 cut(s) 45, 226, 243, 352
DdeI CTNAG 2 cut(s) 29, 90
DpnI GATC 1 cut(s) 5
DpnII GATC 1 cut(s) 3
DraI TTTAAA 1 cut(s) 66
Eco130I CCWWGG 1 cut(s) 40
Eco57I CTGAAG 1 cut(s) 258
EcoT14I CCWWGG 1 cut(s) 40
ErhI CCWWGG 1 cut(s) 40
FaeI CATG 1 cut(s) 174
FaiI YATR 5 cut(s) 172, 216, 229, 231, 252
FatI CATG 1 cut(s) 170
FauNDI CATATG 1 cut(s) 229
FbaI TGATCA 1 cut(s) 3
FokI GGATG 1 cut(s) 23
FspBI CTAG 1 cut(s) 48
Hin1II CATG 1 cut(s) 174
HinfI GANTC 1 cut(s) 338
HphI GGTGA 1 cut(s) 298
Hpy188I TCNGA 3 cut(s) 30, 124, 277
Hpy99I CGWCG 1 cut(s) 301
HpyF3I CTNAG 2 cut(s) 29, 90
Hsp92II CATG 1 cut(s) 174
Ksp22I TGATCA 1 cut(s) 3
Kzo9I GATC 1 cut(s) 3
LpnPI CCDG 2 cut(s) 98, 99
MaeI CTAG 1 cut(s) 48
MalI GATC 1 cut(s) 5
MboI GATC 1 cut(s) 3
MboII GAAGA 2 cut(s) 264, 301
MluCI AATT 2 cut(s) 8, 133
MlyI GAGTC 1 cut(s) 347
MnlI CCTC 2 cut(s) 179, 315
MseI TTAA 3 cut(s) 65, 80, 355
NdeI CATATG 1 cut(s) 229
NdeII GATC 1 cut(s) 3
NlaIII CATG 1 cut(s) 174
PleI GAGTC 1 cut(s) 346
PpsI GAGTC 1 cut(s) 346
SaqAI TTAA 3 cut(s) 65, 80, 355
Sau3AI GATC 1 cut(s) 3
SchI GAGTC 1 cut(s) 347
SetI ASST 3 cut(s) 190, 245, 354
SgeI CNNG 6 cut(s) 53, 60, 98, 125, 183, 256
Sse9I AATT 2 cut(s) 8, 133
SspMI CTAG 1 cut(s) 48
StyI CCWWGG 1 cut(s) 40
TaqI TCGA 2 cut(s) 99, 299
TasI AATT 2 cut(s) 8, 133
Tru1I TTAA 3 cut(s) 65, 80, 355
Tru9I TTAA 3 cut(s) 65, 80, 355
XapI RAATTY 1 cut(s) 133
XspI CTAG 1 cut(s) 48
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.