Rroxscaffold_6G00406600

No description available

Design Primers CRISPR Design

Basic Information

Type: gene
Biological Identity
rosa_roxburghii
GWHEROQ00000006
OG0000136
Physical Location & Seq
Forward (+)
29120809 .. 29121137
329 bp
Loading structure...
UTR
Exon/CDS
Intron
Rroxscaffold_6G00406600.1

Sequence Viewer

Length: 234 bp
ATGAGTGTGTGGAAAAAAGCACGCAACCAATCAAATGCAGATGTTGCCCAAGTCATTGAGGAATATGACAAGAAATTGCTAATGGAACACGAGGACCAGCGAGAACTTAGGGCTGTAAAAGATCGAATATTCCATGAATTGCTTGGGGAAGATGGTCATGGTTATTGTCGTACCTATGGTTCTACTGTGCCTCGCAGTTTGGTGTATCCACGAGGAATCAATGCCTTCTCATAA
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families
Transposase_24

Protein Analysis

77

Amino Acids

8.95

Weight (kDa)

6.83

Isoelectric Point (pI)

35.94

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready
iTOL Interactive Tree Of Life · Most popular EvolView Flexible annotations MEGA Desktop phylogenetics suite FigTree Desktop tree editor

Orthologous Genes (Group: OG0000136)

Species Orthologous Gene IDs
fragaria_vesca FvH4_1g28181 FvH4_1g28182 FvH4_1g28940 FvH4_1g29801 FvH4_1g29802 FvH4_3g03321 FvH4_3g12341 FvH4_3g22002 FvH4_3g22003 FvH4_3g22852 FvH4_3g22860 FvH4_3g32806 FvH4_4g02410 FvH4_4g08110 FvH4_4g09791 FvH4_4g09792 FvH4_4g09830 FvH4_4g09831 FvH4_4g09832 FvH4_4g23330 FvH4_5g25220 FvH4_5g30160 FvH4_5g32340 FvH4_5g37421 FvH4_6g21851 FvH4_6g21852 FvH4_6g22855 FvH4_6g22870 FvH4_6g30440 FvH4_6g30962 FvH4_6g37930
malus_domestica MD16G1158000.v1.1
prunus_persica Prupe.1G266000_v2.0.a1 Prupe.1G266100_v2.0.a1 Prupe.1G266200_v2.0.a1 Prupe.2G006600_v2.0.a1 Prupe.2G110300_v2.0.a1
rosa_chinensis RchiOBHm_Chr1g0322121 RchiOBHm_Chr1g0322131 RchiOBHm_Chr1g0341871 RchiOBHm_Chr1g0346721 RchiOBHm_Chr2g0118081 RchiOBHm_Chr2g0138651 RchiOBHm_Chr3g0468651 RchiOBHm_Chr3g0475981 RchiOBHm_Chr4g0416921 RchiOBHm_Chr5g0068021 RchiOBHm_Chr6g0273901 RchiOBHm_Chr6g0278661 RchiOBHm_Chr6g0281481 RchiOBHm_Chr6g0306081 RchiOBHm_Chr6g0306091 RchiOBHm_Chr7g0220731 RchiOBHm_Chr7g0220741 RchiOBHm_Chr7g0222641 RchiOBHm_Chr7g0225401 RchiOBHm_Chr7g0230481
rosa_laevigata RLG00000001569 RLG00000006184 RLG00000007906 RLG00000009863 RLG00000011359 RLG00000016125 RLG00000018543 RLG00000020693 RLG00000029658 RLG00000029716
rosa_multiflora Rmu_co8244591.1_g000001 Rmu_co8396391.1_g000001 Rmu_sc0000120.1_g000013 Rmu_sc0000239.1_g000047 Rmu_sc0000252.1_g000019 Rmu_sc0000322.1_g000037 Rmu_sc0000376.1_g000010 Rmu_sc0000435.1_g000033 Rmu_sc0001872.1_g000001 Rmu_sc0001992.1_g000011 Rmu_sc0001992.1_g000012 Rmu_sc0002231.1_g000010 Rmu_sc0002372.1_g000033 Rmu_sc0002705.1_g000012 Rmu_sc0003435.1_g000015 Rmu_sc0004084.1_g000042 Rmu_sc0004084.1_g000043 Rmu_sc0004755.1_g000011 Rmu_sc0005391.1_g000010 Rmu_sc0005970.1_g000001 Rmu_sc0006163.1_g000003 Rmu_sc0006422.1_g000004 Rmu_sc0006422.1_g000005 Rmu_sc0006952.1_g000002 Rmu_sc0010937.1_g000007 Rmu_sc0012130.1_g000008 Rmu_sc0024120.1_g000001 Rmu_sc0035618.1_g000001
rosa_roxburghii Rroxscaffold_1G00039230 Rroxscaffold_2G00085900 Rroxscaffold_2G00085910 Rroxscaffold_2G00125240 Rroxscaffold_2G00126850 Rroxscaffold_2G00150980 Rroxscaffold_3G00230580 Rroxscaffold_3G00245050 Rroxscaffold_4G00320680 Rroxscaffold_4G00328800 Rroxscaffold_5G00349640 Rroxscaffold_6G00406600 Rroxscaffold_7G00165570 Rroxscaffold_7G00191490 Rroxscaffold_7G00192700 Rroxscaffold_7G00192710 Rroxscaffold_7G00201190 Rroxscaffold_7G00201620
rosa_rugosa Rorug01G0033100 Rorug01G0089100 Rorug01G0102000 Rorug01G0353100 Rorug01G0353200 Rorug01G0353300 Rorug02G0276900 Rorug02G0362200 Rorug02G0445100 Rorug02G0627600 Rorug02G0627600 Rorug02G0627600 Rorug03G0267700 Rorug03G0267800 Rorug03G0327400 Rorug04G0004500 Rorug04G0006700 Rorug04G0061500 Rorug04G0064700 Rorug04G0073300 Rorug04G0094300 Rorug04G0181200 Rorug04G0181200 Rorug04G0330100 Rorug05G0035600 Rorug05G0038600 Rorug05G0201600 Rorug05G0367700 Rorug05G0407600 Rorug05G0407700 Rorug05G0543400 Rorug06G0012200 Rorug06G0363700.1 Rorug07G0085100
rosa_samantha Rh1AG049700 Rh1AG182700 Rh1AG182800 Rh1BG015500 Rh1BG398700 Rh1BG409100 Rh1CG074100 Rh1CG169200 Rh1CG169300 Rh1CG169400 Rh1DG130800 Rh1DG130900 Rh1DG440400 Rh2DG440900 Rh3AG144700 Rh3BG167100 Rh3DG366800 Rh4AG214400 Rh4BG189700 Rh4BG189800 Rh4CG268600 Rh4DG004400 Rh4DG147900 Rh4DG248300 Rh5AG053900 Rh5AG054000 Rh5AG317200 Rh5AG326400 Rh5AG332600 Rh5AG419700 Rh5CG284900 Rh5CG288600 Rh6AG252700 Rh6AG252800 Rh6AG256900 Rh6AG257000 Rh6AG257500 Rh6BG175300 Rh6DG226200 Rh6DG264500 Rh7AG374000 Rh7AG398100 Rh7BG274900 Rh7BG300500 Rh7BG308200 Rh7BG451200
rosa_wichuraiana Rw1G015860 Rw1G022160 Rw3G016160 Rw3G021170 Rw4G006020 Rw4G008740 Rw5G027400 Rw5G031840 Rw5G036940 Rw6G008320 Rw6G030330 Rw7G033450

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AfaI GTAC 1 cut(s) 172
AspS9I GGNCC 1 cut(s) 94
AvaII GGWCC 1 cut(s) 94
BauI CACGAG 2 cut(s) 89, 210
BccI CCATC 1 cut(s) 146
BciVI GTATCC 1 cut(s) 216
BfuI GTATCC 1 cut(s) 216
Bme18I GGWCC 1 cut(s) 94
BmgT120I GGNCC 1 cut(s) 94
Bsp143I GATC 1 cut(s) 121
BssMI GATC 1 cut(s) 121
BssSI CACGAG 2 cut(s) 89, 210
Bst2BI CACGAG 2 cut(s) 89, 210
Bst4CI ACNGT 1 cut(s) 187
BstAPI GCANNNNNTGC 1 cut(s) 44
BstC8I GCNNGC 1 cut(s) 22
BstDEI CTNAG 1 cut(s) 107
BstKTI GATC 1 cut(s) 124
BstMBI GATC 1 cut(s) 121
BstMWI GCNNNNNNNGC 1 cut(s) 44
BsuI GTATCC 1 cut(s) 216
Cac8I GCNNGC 1 cut(s) 22
Cfr13I GGNCC 1 cut(s) 94
Csp6I GTAC 1 cut(s) 171
CviAII CATG 2 cut(s) 134, 158
CviJI RGCY 1 cut(s) 113
CviKI_1 RGCY 1 cut(s) 113
CviQI GTAC 1 cut(s) 171
DdeI CTNAG 1 cut(s) 107
DpnI GATC 1 cut(s) 123
DpnII GATC 1 cut(s) 121
Eco47I GGWCC 1 cut(s) 94
FaeI CATG 2 cut(s) 137, 161
FaiI YATR 5 cut(s) 66, 135, 159, 177, 232
FatI CATG 2 cut(s) 133, 157
Hin1II CATG 2 cut(s) 137, 161
HinfI GANTC 1 cut(s) 216
HpyCH4III ACNGT 1 cut(s) 187
HpyCH4V TGCA 1 cut(s) 38
HpyF10VI GCNNNNNNNGC 1 cut(s) 44
HpyF3I CTNAG 1 cut(s) 107
Hsp92II CATG 2 cut(s) 137, 161
Kzo9I GATC 1 cut(s) 121
LpnPI CCDG 1 cut(s) 110
MalI GATC 1 cut(s) 123
MboI GATC 1 cut(s) 121
MboII GAAGA 1 cut(s) 161
MluCI AATT 2 cut(s) 74, 137
MnlI CCTC 4 cut(s) 52, 85, 201, 206
MwoI GCNNNNNNNGC 1 cut(s) 44
NdeII GATC 1 cut(s) 121
NlaIII CATG 2 cut(s) 137, 161
PfeI GAWTC 1 cut(s) 216
PspPI GGNCC 1 cut(s) 94
PsrI GAACNNNNNNTAC 2 cut(s) 163, 195
RsaI GTAC 1 cut(s) 172
RsaNI GTAC 1 cut(s) 171
Sau3AI GATC 1 cut(s) 121
Sau96I GGNCC 1 cut(s) 94
SetI ASST 1 cut(s) 176
SinI GGWCC 1 cut(s) 94
Sse9I AATT 2 cut(s) 74, 137
SspI AATATT 1 cut(s) 129
TaaI ACNGT 1 cut(s) 187
TaqI TCGA 1 cut(s) 124
TasI AATT 2 cut(s) 74, 137
TfiI GAWTC 1 cut(s) 216
TspDTI ATGAA 1 cut(s) 150
VpaK11BI GGWCC 1 cut(s) 94
XcmI CCANNNNNNNNNTGG 1 cut(s) 140
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.