Rh6CG100100

No description available

Basic Information

Type: gene
Biological Identity
rosa_samantha
Chr6C
Physical Location & Seq
Reverse (-)
11061920 .. 11081741
19822 bp
Loading structure...
UTR
Exon/CDS
Intron
Rh6CG100100.1

Sequence Viewer

Length: 261 bp
ATGAGGGGATGTGGGATAGTGAATCCTAGTATGCTTGGACTCCTAGAACTGAATAGACATCGTAAGGCAGGCAATTATGAAATTGAGACACAAGTGGTGGATACGCCTTCTGGAATTCCCGCGATGCAAAATTCATTTTTCTTGAATGTCCTTCTCATGACTCAGAGTGAGGAGTCGGCAATGGAGACCCTGAAGAAAATCTCGACCAGCAAAAGGTTCAGAATTACAATCAGCTGTTACATGAAGTGGATGATTGGCTAG
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families
No domains found.

Protein Analysis

86

Amino Acids

9.74

Weight (kDa)

9.14

Isoelectric Point (pI)

38.34

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Orthologous Genes (Group: OG0000505)

Species Orthologous Gene IDs
arabidopsis_thaliana AT2G19910 AT2G19910 AT2G19920 AT2G19920 AT2G19920 AT2G19920 AT2G19930 AT2G19930 AT2G19930
fragaria_vesca FvH4_1g05980 FvH4_1g05990 FvH4_1g05990 FvH4_1g09718
malus_domestica MD02G1064400.v1.1 MD15G1195300.v1.1 MD15G1195400.v1.1
prunus_persica Prupe.7G221200_v2.0.a1 Prupe.7G221200_v2.0.a1 Prupe.7G221200_v2.0.a1 Prupe.7G221200_v2.0.a1
pyrus_communis pycom02g05070 pycom15g17460
rosa_chinensis RchiOBHm_Chr2g0091671 RchiOBHm_Chr2g0091681 RchiOBHm_Chr2g0091691 RchiOBHm_Chr2g0091701 RchiOBHm_Chr2g0091711 RchiOBHm_Chr2g0091721 RchiOBHm_Chr2g0091731 RchiOBHm_Chr5g0014401
rosa_laevigata RLG00000013772 RLG00000016242 RLG00000016244 RLG00000016245 RLG00000016246 RLG00000032105
rosa_multiflora Rmu_co8374041.1_g000001 Rmu_co8478121.1_g000001 Rmu_sc0000897.1_g000005 Rmu_sc0000897.1_g000009
rosa_roxburghii Rroxscaffold_1G00062180 Rroxscaffold_1G00062190 Rroxscaffold_1G00068800 Rroxscaffold_2G00149790 Rroxscaffold_2G00149800 Rroxscaffold_2G00149810
rosa_rugosa Rorug02G0019600 Rorug02G0019700 Rorug02G0019800 Rorug02G0019900 Rorug02G0019900 Rorug02G0020000 Rorug02G0020000 Rorug02G0020100 Rorug02G0020100 Rorug02G0020200 Rorug05G0017800
rosa_samantha Rh2AG064700 Rh2AG064800 Rh2AG064900 Rh2BG063800 Rh2BG063900 Rh2BG064000 Rh2BG064100 Rh2CG065500 Rh2CG065600 Rh2CG065700 Rh2DG063900 Rh2DG064000 Rh2DG064100 Rh2DG064200 Rh2DG381700 Rh5AG056700 Rh5AG056800 Rh5AG056900 Rh5AG112600 Rh5BG109300 Rh5CG063800 Rh5CG121100 Rh5DG053100 Rh5DG108300 Rh6CG100100
rosa_wichuraiana Rw2G005560 Rw2G005580 Rw2G005590 Rw5G005370 Rw5G009770

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AccII CGCG 1 cut(s) 122
AciI CCGC 1 cut(s) 120
AcsI RAATTY 2 cut(s) 114, 130
AcuI CTGAAG 1 cut(s) 212
AfiI CCNNNNNNNGG 1 cut(s) 213
AgsI TTSAA 1 cut(s) 145
AluBI AGCT 1 cut(s) 234
AluI AGCT 1 cut(s) 234
Alw26I GTCTC 2 cut(s) 80, 179
ApoI RAATTY 2 cut(s) 114, 130
BciVI GTATCC 1 cut(s) 94
BcoDI GTCTC 2 cut(s) 80, 179
BfaI CTAG 3 cut(s) 27, 44, 259
BfuI GTATCC 1 cut(s) 94
BmsI GCATC 1 cut(s) 114
BsaI GGTCTC 1 cut(s) 179
Bsc4I CCNNNNNNNGG 1 cut(s) 213
Bse3DI GCAATG 1 cut(s) 186
BseGI GGATG 2 cut(s) 14, 255
BseLI CCNNNNNNNGG 1 cut(s) 213
BseMI GCAATG 1 cut(s) 186
BseMII CTCAG 1 cut(s) 176
BseRI GAGGAG 1 cut(s) 185
Bsh1236I CGCG 1 cut(s) 122
BslI CCNNNNNNNGG 1 cut(s) 213
BsmAI GTCTC 2 cut(s) 80, 179
Bso31I GGTCTC 1 cut(s) 179
BspACI CCGC 1 cut(s) 120
BspCNI CTCAG 1 cut(s) 175
BspFNI CGCG 1 cut(s) 122
BspHI TCATGA 1 cut(s) 156
BspTNI GGTCTC 1 cut(s) 179
BsrDI GCAATG 1 cut(s) 186
BstC8I GCNNGC 1 cut(s) 70
BstDEI CTNAG 1 cut(s) 162
BstF5I GGATG 2 cut(s) 14, 255
BstFNI CGCG 1 cut(s) 122
BstMAI GTCTC 2 cut(s) 80, 179
BstUI CGCG 1 cut(s) 122
BsuI GTATCC 1 cut(s) 94
BtgZI GCGATG 1 cut(s) 137
BtsCI GGATG 2 cut(s) 14, 255
Cac8I GCNNGC 1 cut(s) 70
CciI TCATGA 1 cut(s) 156
CviAII CATG 2 cut(s) 157, 241
CviJI RGCY 2 cut(s) 234, 258
CviKI_1 RGCY 2 cut(s) 234, 258
DdeI CTNAG 1 cut(s) 162
Eco31I GGTCTC 1 cut(s) 179
Eco57I CTGAAG 1 cut(s) 212
EcoRI GAATTC 1 cut(s) 114
FaeI CATG 2 cut(s) 160, 244
FaiI YATR 4 cut(s) 32, 78, 158, 242
FatI CATG 2 cut(s) 156, 240
FauI CCCGC 1 cut(s) 127
FokI GGATG 1 cut(s) 21
FspBI CTAG 3 cut(s) 27, 44, 259
Hin1II CATG 2 cut(s) 160, 244
HinfI GANTC 4 cut(s) 22, 39, 160, 173
Hpy188I TCNGA 2 cut(s) 165, 221
Hpy188III TCNNGA 4 cut(s) 111, 142, 157, 202
HpyAV CCTTC 2 cut(s) 117, 161
HpyCH4V TGCA 1 cut(s) 127
HpyF3I CTNAG 1 cut(s) 162
Hsp92II CATG 2 cut(s) 160, 244
LpnPI CCDG 4 cut(s) 54, 96, 203, 220
LweI GCATC 1 cut(s) 114
MaeI CTAG 3 cut(s) 27, 44, 259
MaeIII GTNAC 1 cut(s) 236
MboII GAAGA 1 cut(s) 205
MluCI AATT 5 cut(s) 73, 81, 114, 130, 222
MlyI GAGTC 3 cut(s) 33, 154, 182
MnlI CCTC 1 cut(s) 163
MspA1I CMGCKG 1 cut(s) 234
MvnI CGCG 1 cut(s) 122
NlaIII CATG 2 cut(s) 160, 244
PagI TCATGA 1 cut(s) 156
PfeI GAWTC 1 cut(s) 22
PleI GAGTC 3 cut(s) 33, 154, 181
PpsI GAGTC 3 cut(s) 33, 154, 181
PvuII CAGCTG 1 cut(s) 234
SchI GAGTC 3 cut(s) 33, 154, 182
SetI ASST 2 cut(s) 218, 236
SfaNI GCATC 1 cut(s) 114
Sse9I AATT 5 cut(s) 73, 81, 114, 130, 222
SsiI CCGC 1 cut(s) 120
SspMI CTAG 3 cut(s) 27, 44, 259
TaqI TCGA 1 cut(s) 203
TasI AATT 5 cut(s) 73, 81, 114, 130, 222
TfiI GAWTC 1 cut(s) 22
TspDTI ATGAA 3 cut(s) 93, 123, 257
XapI RAATTY 2 cut(s) 114, 130
XspI CTAG 3 cut(s) 27, 44, 259
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.