FvH4_1g09709

transposition, RNA-mediated

Basic Information

Type: gene
Biological Identity
fragaria_vesca
Fvb1
Physical Location & Seq
Forward (+)
5241648 .. 5241896
249 bp
Loading structure...
UTR
Exon/CDS
Intron
FvH4_1g09709.t1

Sequence Viewer

Length: 249 bp
ATGATCACGTTGGATAGGAAGCTTGATGTCTTGGTCAAGGCTTTCAATGGTTCGAATCTTGGCAACCAAGCTTGTGGAATTTGCTCACTTTCGGATCACTCTACAGATTCATGTCCGAATGGTGCTTTGAGTGAGGCGGAGTTGAACTTTATGGGACAACAGAGGCAACGTTATGATCCATATTCGAACACTTACAATCCTGGAATTAGAGATCATCCGAATTTTCGGTGGAGTAACAACAATGCTTAA
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.

Protein Analysis

83

Amino Acids

9.15

Weight (kDa)

6.0

Isoelectric Point (pI)

23.47

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Orthologous Genes (Group: OG0000437)

Species Orthologous Gene IDs
arabidopsis_thaliana AT2G06105
fragaria_vesca FvH4_1g09709 FvH4_4g02101 FvH4_4g08975 FvH4_6g23372 FvH4_6g39851 FvH4_c1g00300
malus_domestica MD01G1176100.v1.1 MD09G1284900.v1.1 MD15G1306600.v1.1
prunus_persica Prupe.1G227700_v2.0.a1
pyrus_communis pycom01g00630 pycom01g01020 pycom01g01690 pycom01g01760 pycom01g04190 pycom01g04400 pycom02g18130 pycom03g10160 pycom05g06370 pycom05g08930 pycom06g05590 pycom10g06320 pycom11g14330 pycom11g15320 pycom11g16240 pycom12416g00050 pycom12420g00010 pycom12420g00120 pycom12426g00180 pycom12426g00710 pycom12531g00010 pycom1256g00020 pycom1256g00050 pycom1341g00030 pycom1353g00030 pycom13g23070 pycom13g23210 pycom13g26260 pycom13g26370 pycom13g26470 pycom13g26980 pycom14g08550 pycom14g08850 pycom1534g00040 pycom15g28760 pycom15g31230 pycom1604g00040 pycom16g21900 pycom16g26030 pycom1739g00020 pycom1739g00050 pycom17g12970 pycom17g17960 pycom17g18300 pycom17g18650 pycom2172g00020 pycom2438g00020 pycom436g00370 pycom436g00390 pycom576g00050 pycom76g00020
rosa_chinensis RchiOBHm_Chr1g0320811 RchiOBHm_Chr2g0135321 RchiOBHm_Chr3g0485721 RchiOBHm_Chr7g0236571
rosa_multiflora Rmu_sc0000185.1_g000007 Rmu_sc0002094.1_g000030 Rmu_sc0002764.1_g000007 Rmu_sc0002809.1_g000014 Rmu_sc0003005.1_g000007 Rmu_sc0003798.1_g000005 Rmu_sc0004646.1_g000027 Rmu_sc0004665.1_g000009 Rmu_sc0004818.1_g000001 Rmu_sc0004988.1_g000031 Rmu_sc0006373.1_g000007 Rmu_sc0007142.1_g000015 Rmu_sc0009930.1_g000001 Rmu_sc0011451.1_g000001 Rmu_sc0020424.1_g000001 Rmu_sc0036944.1_g000001 Rmu_ssc0000062.1_g000010
rosa_roxburghii Rroxscaffold_2G00123930 Rroxscaffold_3G00231480 Rroxscaffold_6G00413880
rosa_rugosa Rorug04G0084800
rosa_samantha Rh3BG150500 Rh6DG232400
rosa_wichuraiana Rw2G018400 Rw3G027860 Rw4G021220 Rw6G020670 Rw6G037970

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AciI CCGC 1 cut(s) 137
AclI AACGTT 1 cut(s) 169
AclWI GGATC 2 cut(s) 102, 170
AcsI RAATTY 2 cut(s) 78, 220
AgsI TTSAA 2 cut(s) 46, 145
AjnI CCWGG 1 cut(s) 199
AluBI AGCT 2 cut(s) 22, 71
AluI AGCT 2 cut(s) 22, 71
AlwI GGATC 2 cut(s) 102, 170
ApoI RAATTY 2 cut(s) 78, 220
AsuII TTCGAA 2 cut(s) 53, 185
BciT130I CCWGG 1 cut(s) 201
BclI TGATCA 1 cut(s) 3
BfmI CTRYAG 1 cut(s) 102
Bme1390I CCNGG 1 cut(s) 201
BmrFI CCNGG 1 cut(s) 201
Bpu14I TTCGAA 2 cut(s) 53, 185
BseBI CCWGG 1 cut(s) 201
BseGI GGATG 1 cut(s) 214
BslFI GGGAC 1 cut(s) 168
BsmFI GGGAC 1 cut(s) 168
Bsp119I TTCGAA 2 cut(s) 53, 185
Bsp143I GATC 4 cut(s) 3, 94, 175, 211
BspACI CCGC 1 cut(s) 137
BspPI GGATC 2 cut(s) 102, 170
BspT104I TTCGAA 2 cut(s) 53, 185
BssMI GATC 4 cut(s) 3, 94, 175, 211
Bst2UI CCWGG 1 cut(s) 201
BstBI TTCGAA 2 cut(s) 53, 185
BstF5I GGATG 1 cut(s) 214
BstKTI GATC 4 cut(s) 6, 97, 178, 214
BstMBI GATC 4 cut(s) 3, 94, 175, 211
BstNI CCWGG 1 cut(s) 201
BstSCI CCNGG 1 cut(s) 199
BstSFI CTRYAG 1 cut(s) 102
BstXI CCANNNNNNTGG 1 cut(s) 74
BtsCI GGATG 1 cut(s) 214
CviAII CATG 1 cut(s) 111
CviJI RGCY 3 cut(s) 22, 41, 71
CviKI_1 RGCY 3 cut(s) 22, 41, 71
DpnI GATC 4 cut(s) 5, 96, 177, 213
DpnII GATC 4 cut(s) 3, 94, 175, 211
EciI GGCGGA 1 cut(s) 152
EcoRII CCWGG 1 cut(s) 199
FaeI CATG 1 cut(s) 114
FaiI YATR 4 cut(s) 112, 152, 174, 181
FaqI GGGAC 1 cut(s) 168
FatI CATG 1 cut(s) 110
FbaI TGATCA 1 cut(s) 3
FokI GGATG 1 cut(s) 201
Hin1II CATG 1 cut(s) 114
HindIII AAGCTT 2 cut(s) 20, 69
HinfI GANTC 2 cut(s) 55, 107
Hpy188I TCNGA 3 cut(s) 94, 117, 219
HpyCH4IV ACGT 2 cut(s) 8, 169
HpySE526I ACGT 2 cut(s) 8, 169
Hsp92II CATG 1 cut(s) 114
Ksp22I TGATCA 1 cut(s) 3
Kzo9I GATC 4 cut(s) 3, 94, 175, 211
LpnPI CCDG 2 cut(s) 186, 213
MaeII ACGT 2 cut(s) 8, 169
MaeIII GTNAC 1 cut(s) 233
MalI GATC 4 cut(s) 5, 96, 177, 213
MboI GATC 4 cut(s) 3, 94, 175, 211
MluCI AATT 3 cut(s) 78, 204, 220
MnlI CCTC 2 cut(s) 127, 156
MseI TTAA 1 cut(s) 247
MspR9I CCNGG 1 cut(s) 201
MvaI CCWGG 1 cut(s) 201
NdeII GATC 4 cut(s) 3, 94, 175, 211
NlaIII CATG 1 cut(s) 114
NspV TTCGAA 2 cut(s) 53, 185
PfeI GAWTC 2 cut(s) 55, 107
PfoI TCCNGGA 1 cut(s) 199
Psp1406I AACGTT 1 cut(s) 169
Psp6I CCWGG 1 cut(s) 199
PspGI CCWGG 1 cut(s) 199
SaqAI TTAA 1 cut(s) 247
Sau3AI GATC 4 cut(s) 3, 94, 175, 211
ScrFI CCNGG 1 cut(s) 201
SetI ASST 4 cut(s) 11, 24, 73, 172
SfcI CTRYAG 1 cut(s) 102
SfuI TTCGAA 2 cut(s) 53, 185
Sse9I AATT 3 cut(s) 78, 204, 220
SsiI CCGC 1 cut(s) 137
StyD4I CCNGG 1 cut(s) 199
TaiI ACGT 2 cut(s) 11, 172
TaqI TCGA 2 cut(s) 53, 185
TasI AATT 3 cut(s) 78, 204, 220
TfiI GAWTC 2 cut(s) 55, 107
Tru1I TTAA 1 cut(s) 247
Tru9I TTAA 1 cut(s) 247
TspDTI ATGAA 1 cut(s) 99
XapI RAATTY 2 cut(s) 78, 220
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.