pycom2438g00020

protein kinase activity

Basic Information

Type: gene
Biological Identity
pyrus_communis
tig00002438
Physical Location & Seq
Reverse (-)
35871 .. 40381
4511 bp
Loading structure...
UTR
Exon/CDS
Intron
pycom2438g00020.2

Sequence Viewer

Length: 411 bp
ATGGGCACTCAAGACAAGATCGATGAATTTGAATTGAAGTCAAGTTTGTTGCACCACATTCCAAAGTTCCATGGACTGTCCATGGAGGATCCCAACAAGCATTTGAAGGAGTTCGAGGTGGTGTGTTCGAGCATGACTCCAATTAACGTTGATAGTAGTATTTTGAAGATGAAGGCTTTCCCGTTCTCACTTTTGGAGAAGGCCAAGGATTGGTTATACGAGTTAGCACTCGGAACGGTCACTTCTTGGGAGAGCATGAAGAGGGCGTTTCTTGAAAAGTTCTTTCCTACTTCAAGAGTCATTCTCTTGAGAAAGAAGATTAGCGGAATCCAACAAAGTCAAGGGAGTCTTTTCCAACATACTACGAGCGTTTTAAAGCCCTTGTTGCATCATGTCCTCAACATCAAATGA
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.

Protein Analysis

137

Amino Acids

15.62

Weight (kDa)

9.24

Isoelectric Point (pI)

37.72

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Orthologous Genes (Group: OG0000437)

Species Orthologous Gene IDs
arabidopsis_thaliana AT2G06105
fragaria_vesca FvH4_1g09709 FvH4_4g02101 FvH4_4g08975 FvH4_6g23372 FvH4_6g39851 FvH4_c1g00300
malus_domestica MD01G1176100.v1.1 MD09G1284900.v1.1 MD15G1306600.v1.1
prunus_persica Prupe.1G227700_v2.0.a1
pyrus_communis pycom01g00630 pycom01g01020 pycom01g01690 pycom01g01760 pycom01g04190 pycom01g04400 pycom02g18130 pycom03g10160 pycom05g06370 pycom05g08930 pycom06g05590 pycom10g06320 pycom11g14330 pycom11g15320 pycom11g16240 pycom12416g00050 pycom12420g00010 pycom12420g00120 pycom12426g00180 pycom12426g00710 pycom12531g00010 pycom1256g00020 pycom1256g00050 pycom1341g00030 pycom1353g00030 pycom13g23070 pycom13g23210 pycom13g26260 pycom13g26370 pycom13g26470 pycom13g26980 pycom14g08550 pycom14g08850 pycom1534g00040 pycom15g28760 pycom15g31230 pycom1604g00040 pycom16g21900 pycom16g26030 pycom1739g00020 pycom1739g00050 pycom17g12970 pycom17g17960 pycom17g18300 pycom17g18650 pycom2172g00020 pycom2438g00020 pycom436g00370 pycom436g00390 pycom576g00050 pycom76g00020
rosa_chinensis RchiOBHm_Chr1g0320811 RchiOBHm_Chr2g0135321 RchiOBHm_Chr3g0485721 RchiOBHm_Chr7g0236571
rosa_multiflora Rmu_sc0000185.1_g000007 Rmu_sc0002094.1_g000030 Rmu_sc0002764.1_g000007 Rmu_sc0002809.1_g000014 Rmu_sc0003005.1_g000007 Rmu_sc0003798.1_g000005 Rmu_sc0004646.1_g000027 Rmu_sc0004665.1_g000009 Rmu_sc0004818.1_g000001 Rmu_sc0004988.1_g000031 Rmu_sc0006373.1_g000007 Rmu_sc0007142.1_g000015 Rmu_sc0009930.1_g000001 Rmu_sc0011451.1_g000001 Rmu_sc0020424.1_g000001 Rmu_sc0036944.1_g000001 Rmu_ssc0000062.1_g000010
rosa_roxburghii Rroxscaffold_2G00123930 Rroxscaffold_3G00231480 Rroxscaffold_6G00413880
rosa_rugosa Rorug04G0084800
rosa_samantha Rh3BG150500 Rh6DG232400
rosa_wichuraiana Rw2G018400 Rw3G027860 Rw4G021220 Rw6G020670 Rw6G037970

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AccB7I CCANNNNNTGG 1 cut(s) 210
AciI CCGC 1 cut(s) 324
AclI AACGTT 1 cut(s) 147
AclWI GGATC 2 cut(s) 83, 96
AcsI RAATTY 1 cut(s) 26
AfiI CCNNNNNNNGG 1 cut(s) 210
AgsI TTSAA 6 cut(s) 32, 37, 106, 166, 275, 294
AlwI GGATC 2 cut(s) 83, 96
AoxI GGCC 1 cut(s) 201
ApoI RAATTY 1 cut(s) 26
Asp700I GAANNNNTTC 2 cut(s) 110, 176
BaeGI GKGCMC 1 cut(s) 8
BamHI GGATCC 1 cut(s) 88
BmiI GGNNCC 1 cut(s) 90
BmsI GCATC 1 cut(s) 397
BplI GAGNNNNNCTC 4 cut(s) 121, 153, 288, 320
BpuEI CTTGAG 1 cut(s) 328
Bsa29I ATCGAT 1 cut(s) 21
BsaJI CCNNGG 3 cut(s) 70, 81, 204
Bsc4I CCNNNNNNNGG 1 cut(s) 210
BseCI ATCGAT 1 cut(s) 21
BseDI CCNNGG 3 cut(s) 70, 81, 204
BseLI CCNNNNNNNGG 1 cut(s) 210
BseSI GKGCMC 1 cut(s) 8
BshFI GGCC 1 cut(s) 203
BshVI ATCGAT 1 cut(s) 21
BslI CCNNNNNNNGG 1 cut(s) 210
BsnI GGCC 1 cut(s) 203
Bsp1286I GDGCHC 1 cut(s) 8
Bsp143I GATC 2 cut(s) 18, 88
Bsp19I CCATGG 2 cut(s) 70, 81
BspACI CCGC 1 cut(s) 324
BspANI GGCC 1 cut(s) 203
BspDI ATCGAT 1 cut(s) 21
BspLI GGNNCC 1 cut(s) 90
BspPI GGATC 2 cut(s) 83, 96
BssECI CCNNGG 3 cut(s) 70, 81, 204
BssMI GATC 2 cut(s) 18, 88
BssT1I CCWWGG 3 cut(s) 70, 81, 204
Bst4CI ACNGT 2 cut(s) 78, 238
Bst6I CTCTTC 1 cut(s) 254
BstDSI CCRYGG 2 cut(s) 70, 81
BstKTI GATC 2 cut(s) 21, 91
BstMBI GATC 2 cut(s) 18, 88
BstMWI GCNNNNNNNGC 1 cut(s) 385
BstSLI GKGCMC 1 cut(s) 8
BstX2I RGATCY 1 cut(s) 88
BstYI RGATCY 1 cut(s) 88
Bsu15I ATCGAT 1 cut(s) 21
BsuRI GGCC 1 cut(s) 203
BsuTUI ATCGAT 1 cut(s) 21
BtgI CCRYGG 2 cut(s) 70, 81
ClaI ATCGAT 1 cut(s) 21
CviAII CATG 5 cut(s) 71, 82, 133, 256, 392
CviJI RGCY 3 cut(s) 176, 203, 379
CviKI_1 RGCY 3 cut(s) 176, 203, 379
DpnI GATC 2 cut(s) 20, 90
DpnII GATC 2 cut(s) 18, 88
DraI TTTAAA 1 cut(s) 375
Eam1104I CTCTTC 1 cut(s) 254
EarI CTCTTC 1 cut(s) 254
Eco130I CCWWGG 3 cut(s) 70, 81, 204
EcoT14I CCWWGG 3 cut(s) 70, 81, 204
ErhI CCWWGG 3 cut(s) 70, 81, 204
FaeI CATG 5 cut(s) 74, 85, 136, 259, 395
FaiI YATR 7 cut(s) 72, 83, 134, 217, 257, 360, 393
FalI AAGNNNNNCTT 2 cut(s) 333, 365
FatI CATG 5 cut(s) 70, 81, 132, 255, 391
HaeIII GGCC 1 cut(s) 203
Hin1II CATG 5 cut(s) 74, 85, 136, 259, 395
HinfI GANTC 4 cut(s) 136, 297, 327, 346
Hpy188I TCNGA 1 cut(s) 233
Hpy188III TCNNGA 4 cut(s) 11, 272, 294, 307
HpyAV CCTTC 3 cut(s) 100, 166, 193
HpyCH4III ACNGT 2 cut(s) 78, 238
HpyCH4IV ACGT 1 cut(s) 147
HpyCH4V TGCA 2 cut(s) 52, 388
HpyF10VI GCNNNNNNNGC 1 cut(s) 385
HpySE526I ACGT 1 cut(s) 147
Hsp92II CATG 5 cut(s) 74, 85, 136, 259, 395
Kzo9I GATC 2 cut(s) 18, 88
LweI GCATC 1 cut(s) 397
MaeII ACGT 1 cut(s) 147
MaeIII GTNAC 1 cut(s) 238
MalI GATC 2 cut(s) 20, 90
MboI GATC 2 cut(s) 18, 88
MboII GAAGA 3 cut(s) 178, 271, 328
MflI RGATCY 1 cut(s) 88
MhlI GDGCHC 1 cut(s) 8
MluCI AATT 3 cut(s) 26, 32, 141
MlyI GAGTC 3 cut(s) 130, 306, 355
MmeI TCCRAC 2 cut(s) 355, 379
MnlI CCTC 4 cut(s) 79, 109, 255, 407
MroXI GAANNNNTTC 2 cut(s) 110, 176
MseI TTAA 2 cut(s) 144, 374
MwoI GCNNNNNNNGC 1 cut(s) 385
NcoI CCATGG 2 cut(s) 70, 81
NdeII GATC 2 cut(s) 18, 88
NlaIII CATG 5 cut(s) 74, 85, 136, 259, 395
NlaIV GGNNCC 1 cut(s) 90
NmuCI GTSAC 1 cut(s) 238
PdmI GAANNNNTTC 2 cut(s) 110, 176
PfeI GAWTC 1 cut(s) 327
PflMI CCANNNNNTGG 1 cut(s) 210
PleI GAGTC 3 cut(s) 130, 305, 354
PpsI GAGTC 3 cut(s) 130, 305, 354
Psp1406I AACGTT 1 cut(s) 147
PspN4I GGNNCC 1 cut(s) 90
PsuI RGATCY 1 cut(s) 88
SaqAI TTAA 2 cut(s) 144, 374
Sau3AI GATC 2 cut(s) 18, 88
SchI GAGTC 3 cut(s) 130, 306, 355
SduI GDGCHC 1 cut(s) 8
SetI ASST 2 cut(s) 120, 150
SfaNI GCATC 1 cut(s) 397
SmlI CTYRAG 2 cut(s) 9, 307
SmoI CTYRAG 2 cut(s) 9, 307
Sse9I AATT 3 cut(s) 26, 32, 141
SsiI CCGC 1 cut(s) 324
StyI CCWWGG 3 cut(s) 70, 81, 204
TaaI ACNGT 2 cut(s) 78, 238
TaiI ACGT 1 cut(s) 150
TaqI TCGA 3 cut(s) 21, 114, 128
TasI AATT 3 cut(s) 26, 32, 141
TfiI GAWTC 1 cut(s) 327
Tru1I TTAA 2 cut(s) 144, 374
Tru9I TTAA 2 cut(s) 144, 374
TseFI GTSAC 1 cut(s) 238
Tsp45I GTSAC 1 cut(s) 238
TspDTI ATGAA 3 cut(s) 39, 185, 272
Van91I CCANNNNNTGG 1 cut(s) 210
XapI RAATTY 1 cut(s) 26
XmnI GAANNNNTTC 2 cut(s) 110, 176
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.