Rmu_sc0009930.1_g000001

transposition, RNA-mediated

Design Primers CRISPR Design

Basic Information

Type: gene
Biological Identity
rosa_multiflora
Rmu_sc0009930.1
OG0000437
Physical Location & Seq
Forward (+)
311 .. 1297
987 bp
Loading structure...
UTR
Exon/CDS
Intron
Rmu_sc0009930.1_g000001.1.cds

Sequence Viewer

Length: 987 bp
atgatccttatagcaacacttataatcccgagtggaggaatcaccctaattttggttggggtgggaatcaaaaccgtgaacaaggtcaaggtccaaaggcaaggaggtggctatcaaggtgcaagtagctcacacttcaacaatcaaggagcaaacaatgcttatcatgctcctagaccaccttatcaagcaccatctcaacaacctctacctttacaacaaccccaagtgccaattcaagaagcaagaaagacacctacccttgaagaaataatggcgacctttgtgaacaatcaagcaaagcaagatgagaagatcaatgtcattcaacaaagtgtgagcaagcttgaggttcaaatggggcaactagctagtgagttaagtcaaatgaggcaaggtgtgtttccaagccaagtggagactaacccaagacatgaagccaaagctattaccaccttgagaagtggaaggcaagtggagaacaatgtgtacatgcctaccaatgaggaagatgtaactccaagggagccacccgattttgaaaaaagatcaaaggggaaagcaagagagttgtcacatggagaagtcatcttaggcttcaatgatggtgaagaagaagctttgaatgataagaagaatgcttatgccgatgagaagcaagaagaagccttgaaggacaatttcaatgccaaggttggaactcatgataatgaagactctccttctactctaattgaaaggccattcaaaagaggtatgaccttcaatcctcctttgaagattgtgcaagatgaagaagtgtctctcccttaccctcaagctatattgcaacaagagaaaaaactcaagaaagagagccaattgagggagatgattgatttgttcaagaaggttcatataaatattccactccttgaagccgtgaagacaatcccatcttatgctaagttcttgaaggatatgtgcatgaagaagaaaaagttctaa
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families
RVT_1 Retrotrans_gag rve

Protein Analysis

328

Amino Acids

36.86

Weight (kDa)

8.67

Isoelectric Point (pI)

56.35

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready
iTOL Interactive Tree Of Life · Most popular EvolView Flexible annotations MEGA Desktop phylogenetics suite FigTree Desktop tree editor

Orthologous Genes (Group: OG0000437)

Species Orthologous Gene IDs
arabidopsis_thaliana AT2G06105
fragaria_vesca FvH4_1g09709 FvH4_4g02101 FvH4_4g08975 FvH4_6g23372 FvH4_6g39851 FvH4_c1g00300
malus_domestica MD01G1176100.v1.1 MD09G1284900.v1.1 MD15G1306600.v1.1
prunus_persica Prupe.1G227700_v2.0.a1
pyrus_communis pycom01g00630 pycom01g01020 pycom01g01690 pycom01g01760 pycom01g04190 pycom01g04400 pycom02g18130 pycom03g10160 pycom05g06370 pycom05g08930 pycom06g05590 pycom10g06320 pycom11g14330 pycom11g15320 pycom11g16240 pycom12416g00050 pycom12420g00010 pycom12420g00120 pycom12426g00180 pycom12426g00710 pycom12531g00010 pycom1256g00020 pycom1256g00050 pycom1341g00030 pycom1353g00030 pycom13g23070 pycom13g23210 pycom13g26260 pycom13g26370 pycom13g26470 pycom13g26980 pycom14g08550 pycom14g08850 pycom1534g00040 pycom15g28760 pycom15g31230 pycom1604g00040 pycom16g21900 pycom16g26030 pycom1739g00020 pycom1739g00050 pycom17g12970 pycom17g17960 pycom17g18300 pycom17g18650 pycom2172g00020 pycom2438g00020 pycom436g00370 pycom436g00390 pycom576g00050 pycom76g00020
rosa_chinensis RchiOBHm_Chr1g0320811 RchiOBHm_Chr2g0135321 RchiOBHm_Chr3g0485721 RchiOBHm_Chr7g0236571
rosa_multiflora Rmu_sc0000185.1_g000007 Rmu_sc0002094.1_g000030 Rmu_sc0002764.1_g000007 Rmu_sc0002809.1_g000014 Rmu_sc0003005.1_g000007 Rmu_sc0003798.1_g000005 Rmu_sc0004646.1_g000027 Rmu_sc0004665.1_g000009 Rmu_sc0004818.1_g000001 Rmu_sc0004988.1_g000031 Rmu_sc0006373.1_g000007 Rmu_sc0007142.1_g000015 Rmu_sc0009930.1_g000001 Rmu_sc0011451.1_g000001 Rmu_sc0020424.1_g000001 Rmu_sc0036944.1_g000001 Rmu_ssc0000062.1_g000010
rosa_roxburghii Rroxscaffold_2G00123930 Rroxscaffold_3G00231480 Rroxscaffold_6G00413880
rosa_rugosa Rorug04G0084800
rosa_samantha Rh3BG150500 Rh6DG232400
rosa_wichuraiana Rw2G018400 Rw3G027860 Rw4G021220 Rw6G020670 Rw6G037970

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AanI TTATAA 1 cut(s) 23
AfaI GTAC 1 cut(s) 491
AfiI CCNNNNNNNGG 3 cut(s) 35, 52, 865
AjuI GAANNNNNNNTTGG 2 cut(s) 219, 251
AluBI AGCT 6 cut(s) 129, 346, 371, 446, 620, 821
AluI AGCT 6 cut(s) 129, 346, 371, 446, 620, 821
Alw26I GTCTC 2 cut(s) 413, 807
Ama87I CYCGRG 1 cut(s) 28
AoxI GGCC 1 cut(s) 740
Asp700I GAANNNNTTC 1 cut(s) 980
AspS9I GGNCC 1 cut(s) 91
AsuHPI GGTGA 2 cut(s) 34, 620
AvaI CYCGRG 1 cut(s) 28
AvaII GGWCC 1 cut(s) 91
BbsI GAAGAC 2 cut(s) 720, 932
BccI CCATC 3 cut(s) 202, 599, 943
BceAI ACGGC 1 cut(s) 905
BcoDI GTCTC 2 cut(s) 413, 807
BfaI CTAG 3 cut(s) 174, 368, 372
Bme18I GGWCC 1 cut(s) 91
BmeT110I CYCGRG 1 cut(s) 28
BmgT120I GGNCC 1 cut(s) 91
BmiI GGNNCC 1 cut(s) 528
BpiI GAAGAC 2 cut(s) 720, 932
BpuEI CTTGAG 4 cut(s) 368, 478, 801, 830
BsaJI CCNNGG 2 cut(s) 521, 690
Bsc4I CCNNNNNNNGG 3 cut(s) 35, 52, 865
BseDI CCNNGG 2 cut(s) 521, 690
BseLI CCNNNNNNNGG 3 cut(s) 35, 52, 865
BshFI GGCC 1 cut(s) 742
BsiHKCI CYCGRG 1 cut(s) 28
BslI CCNNNNNNNGG 3 cut(s) 35, 52, 865
BsmAI GTCTC 2 cut(s) 413, 807
BsmI GAATGC 1 cut(s) 643
BsnI GGCC 1 cut(s) 742
BsoBI CYCGRG 1 cut(s) 28
Bsp1407I TGTACA 1 cut(s) 489
Bsp143I GATC 3 cut(s) 3, 315, 548
BspANI GGCC 1 cut(s) 742
BspHI TCATGA 1 cut(s) 703
BspLI GGNNCC 1 cut(s) 528
BsrGI TGTACA 1 cut(s) 489
BssECI CCNNGG 2 cut(s) 521, 690
BssMI GATC 3 cut(s) 3, 315, 548
BssT1I CCWWGG 2 cut(s) 521, 690
Bst4CI ACNGT 1 cut(s) 76
BstAPI GCANNNNNTGC 1 cut(s) 158
BstAUI TGTACA 1 cut(s) 489
BstC8I GCNNGC 1 cut(s) 344
BstDEI CTNAG 2 cut(s) 592, 945
BstKTI GATC 3 cut(s) 6, 318, 551
BstMAI GTCTC 2 cut(s) 413, 807
BstMBI GATC 3 cut(s) 3, 315, 548
BstMWI GCNNNNNNNGC 2 cut(s) 158, 167
BstNSI RCATGY 1 cut(s) 496
BstV2I GAAGAC 2 cut(s) 720, 932
BsuRI GGCC 1 cut(s) 742
Cac8I GCNNGC 1 cut(s) 344
CciI TCATGA 1 cut(s) 703
Cfr13I GGNCC 1 cut(s) 91
Csp6I GTAC 1 cut(s) 490
CspCI CAANNNNNGTGG 2 cut(s) 396, 431
CviAII CATG 6 cut(s) 167, 434, 493, 578, 704, 967
CviQI GTAC 1 cut(s) 490
DdeI CTNAG 2 cut(s) 592, 945
DpnI GATC 3 cut(s) 5, 317, 550
DpnII GATC 3 cut(s) 3, 315, 548
Eco130I CCWWGG 2 cut(s) 521, 690
Eco47I GGWCC 1 cut(s) 91
Eco88I CYCGRG 1 cut(s) 28
EcoT14I CCWWGG 2 cut(s) 521, 690
ErhI CCWWGG 2 cut(s) 521, 690
FaeI CATG 6 cut(s) 170, 437, 496, 581, 707, 970
FatI CATG 6 cut(s) 166, 433, 492, 577, 703, 966
FspBI CTAG 3 cut(s) 174, 368, 372
HaeIII GGCC 1 cut(s) 742
Hin1II CATG 6 cut(s) 170, 437, 496, 581, 707, 970
HindIII AAGCTT 2 cut(s) 344, 618
HinfI GANTC 3 cut(s) 39, 66, 716
HphI GGTGA 2 cut(s) 34, 620
Hpy166II GTNNAC 3 cut(s) 79, 289, 490
Hpy188III TCNNGA 6 cut(s) 28, 239, 704, 847, 886, 952
Hpy8I GTNNAC 3 cut(s) 79, 289, 490
HpyAV CCTTC 6 cut(s) 462, 667, 732, 772, 883, 949
HpyCH4III ACNGT 1 cut(s) 76
HpyCH4V TGCA 4 cut(s) 122, 787, 829, 966
HpyF10VI GCNNNNNNNGC 2 cut(s) 158, 167
HpyF3I CTNAG 2 cut(s) 592, 945
Hsp92II CATG 6 cut(s) 170, 437, 496, 581, 707, 970
Kzo9I GATC 3 cut(s) 3, 315, 548
LmnI GCTCC 3 cut(s) 149, 175, 526
MaeI CTAG 3 cut(s) 174, 368, 372
MaeIII GTNAC 2 cut(s) 514, 573
MalI GATC 3 cut(s) 5, 317, 550
MboI GATC 3 cut(s) 3, 315, 548
MfeI CAATTG 1 cut(s) 860
MluCI AATT 5 cut(s) 48, 234, 679, 732, 860
MlyI GAGTC 1 cut(s) 710
MmeI TCCRAC 1 cut(s) 676
MroXI GAANNNNTTC 1 cut(s) 980
MseI TTAA 1 cut(s) 380
MslI CAYNNNNRTG 1 cut(s) 708
MunI CAATTG 1 cut(s) 860
Mva1269I GAATGC 1 cut(s) 643
MwoI GCNNNNNNNGC 2 cut(s) 158, 167
NdeII GATC 3 cut(s) 3, 315, 548
NlaIII CATG 6 cut(s) 170, 437, 496, 581, 707, 970
NlaIV GGNNCC 1 cut(s) 528
NmuCI GTSAC 1 cut(s) 573
NspI RCATGY 1 cut(s) 496
PagI TCATGA 1 cut(s) 703
PctI GAATGC 1 cut(s) 643
PdmI GAANNNNTTC 1 cut(s) 980
PfeI GAWTC 2 cut(s) 39, 66
PleI GAGTC 1 cut(s) 710
PpsI GAGTC 1 cut(s) 710
PsiI TTATAA 1 cut(s) 23
PspN4I GGNNCC 1 cut(s) 528
PspPI GGNCC 1 cut(s) 91
PsrI GAACNNNNNNTAC 2 cut(s) 473, 505
RsaI GTAC 1 cut(s) 491
RsaNI GTAC 1 cut(s) 490
RseI CAYNNNNRTG 1 cut(s) 708
SaqAI TTAA 1 cut(s) 380
Sau3AI GATC 3 cut(s) 3, 315, 548
Sau96I GGNCC 1 cut(s) 91
SchI GAGTC 1 cut(s) 710
SinI GGWCC 1 cut(s) 91
SmiMI CAYNNNNRTG 1 cut(s) 708
SmlI CTYRAG 4 cut(s) 347, 457, 816, 845
SmoI CTYRAG 4 cut(s) 347, 457, 816, 845
Sse9I AATT 5 cut(s) 48, 234, 679, 732, 860
SspI AATATT 1 cut(s) 904
SspMI CTAG 3 cut(s) 174, 368, 372
StyI CCWWGG 2 cut(s) 521, 690
TaaI ACNGT 1 cut(s) 76
TasI AATT 5 cut(s) 48, 234, 679, 732, 860
TatI WGTACW 1 cut(s) 489
TfiI GAWTC 2 cut(s) 39, 66
Tru1I TTAA 1 cut(s) 380
Tru9I TTAA 1 cut(s) 380
TseFI GTSAC 1 cut(s) 573
Tsp45I GTSAC 1 cut(s) 573
TspDTI ATGAA 5 cut(s) 450, 726, 807, 884, 983
VpaK11BI GGWCC 1 cut(s) 91
XceI RCATGY 1 cut(s) 496
XmnI GAANNNNTTC 1 cut(s) 980
XspI CTAG 3 cut(s) 174, 368, 372
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.