Rmu_ssc0000062.1_g000010

Aspartyl protease

Basic Information

Type: gene
Biological Identity
rosa_multiflora
Rmu_ssc0000062.1
Physical Location & Seq
Forward (+)
54829 .. 55569
741 bp
Loading structure...
UTR
Exon/CDS
Intron
Rmu_ssc0000062.1_g000010.1.cds

Sequence Viewer

Length: 741 bp
atgcaaaagaagcttgacatgattctacaagcacaaggaagacccctcaatcaaatggcatcaccaagccaaattagggagcctagtttgggagtcaaagccatggagcaagcttgtttgatttgtgaaagtgtgtatcatagcacaacggagtgttcacaaagcgatatgtatccggaattgatagagcaatgcaatctccttgactaccaaacaaagccaaagaatgatccttacagcaacatttataatcccgggtggaggaatcaccctaattttggttggggtgggaatcaaaactgtgaacaaggtcaaggttaccaaaggcgaggaggtggatatcaaggtgcaagtagcttacatttcaacaatcaaggaacaaacaatgcttatcatgctcctagaccaccttatcaagcaccatctcaacaacctctacctctacaacaaccccaagtaccaatacaagcaagaaagacacctacctttgaaaaaatgatggcggcctttgtgaacaatcaagcaaagcaagatgagaagatcaatgtcatccaacaaagtgtgagcaagcttgaggtgcaaattgggcaactagcccataagttaagccaaatgaagcaaggagtgtttccaagtcaagtggtcaacaatccaatgcatgaagccaaggccatcaccattttgagaagtagaaggcaagttgagaacatgtgtacatttccactaatgaagaagttgtaa
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families
No domains found.

Protein Analysis

246

Amino Acids

27.83

Weight (kDa)

9.2

Isoelectric Point (pI)

66.47

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Orthologous Genes (Group: OG0000437)

Species Orthologous Gene IDs
arabidopsis_thaliana AT2G06105
fragaria_vesca FvH4_1g09709 FvH4_4g02101 FvH4_4g08975 FvH4_6g23372 FvH4_6g39851 FvH4_c1g00300
malus_domestica MD01G1176100.v1.1 MD09G1284900.v1.1 MD15G1306600.v1.1
prunus_persica Prupe.1G227700_v2.0.a1
pyrus_communis pycom01g00630 pycom01g01020 pycom01g01690 pycom01g01760 pycom01g04190 pycom01g04400 pycom02g18130 pycom03g10160 pycom05g06370 pycom05g08930 pycom06g05590 pycom10g06320 pycom11g14330 pycom11g15320 pycom11g16240 pycom12416g00050 pycom12420g00010 pycom12420g00120 pycom12426g00180 pycom12426g00710 pycom12531g00010 pycom1256g00020 pycom1256g00050 pycom1341g00030 pycom1353g00030 pycom13g23070 pycom13g23210 pycom13g26260 pycom13g26370 pycom13g26470 pycom13g26980 pycom14g08550 pycom14g08850 pycom1534g00040 pycom15g28760 pycom15g31230 pycom1604g00040 pycom16g21900 pycom16g26030 pycom1739g00020 pycom1739g00050 pycom17g12970 pycom17g17960 pycom17g18300 pycom17g18650 pycom2172g00020 pycom2438g00020 pycom436g00370 pycom436g00390 pycom576g00050 pycom76g00020
rosa_chinensis RchiOBHm_Chr1g0320811 RchiOBHm_Chr2g0135321 RchiOBHm_Chr3g0485721 RchiOBHm_Chr7g0236571
rosa_multiflora Rmu_sc0000185.1_g000007 Rmu_sc0002094.1_g000030 Rmu_sc0002764.1_g000007 Rmu_sc0002809.1_g000014 Rmu_sc0003005.1_g000007 Rmu_sc0003798.1_g000005 Rmu_sc0004646.1_g000027 Rmu_sc0004665.1_g000009 Rmu_sc0004818.1_g000001 Rmu_sc0004988.1_g000031 Rmu_sc0006373.1_g000007 Rmu_sc0007142.1_g000015 Rmu_sc0009930.1_g000001 Rmu_sc0011451.1_g000001 Rmu_sc0020424.1_g000001 Rmu_sc0036944.1_g000001 Rmu_ssc0000062.1_g000010
rosa_roxburghii Rroxscaffold_2G00123930 Rroxscaffold_3G00231480 Rroxscaffold_6G00413880
rosa_rugosa Rorug04G0084800
rosa_samantha Rh3BG150500 Rh6DG232400
rosa_wichuraiana Rw2G018400 Rw3G027860 Rw4G021220 Rw6G020670 Rw6G037970

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AanI TTATAA 1 cut(s) 249
AccIII TCCGGA 1 cut(s) 175
AciI CCGC 1 cut(s) 503
AclWI GGATC 1 cut(s) 224
AfaI GTAC 2 cut(s) 459, 715
AfiI CCNNNNNNNGG 4 cut(s) 76, 89, 261, 278
AflIII ACRYGT 1 cut(s) 708
AgsI TTSAA 2 cut(s) 367, 491
AluBI AGCT 4 cut(s) 13, 113, 357, 571
AluI AGCT 4 cut(s) 13, 113, 357, 571
AlwI GGATC 1 cut(s) 224
Ama87I CYCGRG 1 cut(s) 254
Aor13HI TCCGGA 1 cut(s) 175
AoxI GGCC 2 cut(s) 504, 669
AsuC2I CCSGG 2 cut(s) 255, 256
AsuHPI GGTGA 3 cut(s) 54, 260, 667
AvaI CYCGRG 1 cut(s) 254
BbsI GAAGAC 1 cut(s) 46
BccI CCATC 3 cut(s) 430, 493, 680
BciVI GTATCC 1 cut(s) 183
BcnI CCSGG 2 cut(s) 255, 256
BfaI CTAG 3 cut(s) 84, 402, 593
BfuI GTATCC 1 cut(s) 183
BisI GCNGC 1 cut(s) 504
BlsI GCNGC 1 cut(s) 505
Bme1390I CCNGG 2 cut(s) 255, 256
BmeT110I CYCGRG 1 cut(s) 254
BmiI GGNNCC 1 cut(s) 81
BmrFI CCNGG 2 cut(s) 255, 256
BmsI GCATC 1 cut(s) 68
BpiI GAAGAC 1 cut(s) 46
BpuEI CTTGAG 1 cut(s) 593
BpuMI CCSGG 2 cut(s) 255, 256
BsaBI GATNNNNATC 1 cut(s) 171
BsaJI CCNNGG 3 cut(s) 102, 254, 666
BsaWI WCCGGW 1 cut(s) 175
Bsc4I CCNNNNNNNGG 4 cut(s) 76, 89, 261, 278
Bse3DI GCAATG 1 cut(s) 197
Bse8I GATNNNNATC 1 cut(s) 171
BseAI TCCGGA 1 cut(s) 175
BseDI CCNNGG 3 cut(s) 102, 254, 666
BseGI GGATG 1 cut(s) 549
BseJI GATNNNNATC 1 cut(s) 171
BseLI CCNNNNNNNGG 4 cut(s) 76, 89, 261, 278
BseMI GCAATG 1 cut(s) 197
BseRI GAGGAG 1 cut(s) 345
BshFI GGCC 2 cut(s) 506, 671
BsiHKCI CYCGRG 1 cut(s) 254
BsiSI CCGG 2 cut(s) 176, 255
BslI CCNNNNNNNGG 4 cut(s) 76, 89, 261, 278
BsnI GGCC 2 cut(s) 506, 671
BsoBI CYCGRG 1 cut(s) 254
Bsp13I TCCGGA 1 cut(s) 175
Bsp1407I TGTACA 1 cut(s) 713
Bsp143I GATC 2 cut(s) 229, 540
Bsp19I CCATGG 1 cut(s) 102
BspACI CCGC 1 cut(s) 503
BspANI GGCC 2 cut(s) 506, 671
BspEI TCCGGA 1 cut(s) 175
BspLI GGNNCC 1 cut(s) 81
BspPI GGATC 1 cut(s) 224
BsrDI GCAATG 1 cut(s) 197
BsrGI TGTACA 1 cut(s) 713
BssECI CCNNGG 3 cut(s) 102, 254, 666
BssMI GATC 2 cut(s) 229, 540
BssT1I CCWWGG 2 cut(s) 102, 666
Bst4CI ACNGT 1 cut(s) 302
BstAUI TGTACA 1 cut(s) 713
BstC8I GCNNGC 2 cut(s) 111, 569
BstDSI CCRYGG 1 cut(s) 102
BstEII GGTNACC 1 cut(s) 317
BstF5I GGATG 1 cut(s) 549
BstKTI GATC 2 cut(s) 232, 543
BstMBI GATC 2 cut(s) 229, 540
BstMWI GCNNNNNNNGC 4 cut(s) 10, 395, 577, 586
BstNSI RCATGY 1 cut(s) 712
BstPI GGTNACC 1 cut(s) 317
BstSCI CCNGG 2 cut(s) 253, 254
BstV2I GAAGAC 1 cut(s) 46
BsuI GTATCC 1 cut(s) 183
BsuRI GGCC 2 cut(s) 506, 671
BtgI CCRYGG 1 cut(s) 102
BtsCI GGATG 1 cut(s) 549
Cac8I GCNNGC 2 cut(s) 111, 569
Cfr9I CCCGGG 1 cut(s) 254
Csp6I GTAC 2 cut(s) 458, 714
CspCI CAANNNNNGTGG 2 cut(s) 621, 656
CviAII CATG 5 cut(s) 19, 103, 395, 659, 709
CviQI GTAC 2 cut(s) 458, 714
DpnI GATC 2 cut(s) 231, 542
DpnII GATC 2 cut(s) 229, 540
Eco130I CCWWGG 2 cut(s) 102, 666
Eco32I GATATC 1 cut(s) 341
Eco88I CYCGRG 1 cut(s) 254
Eco91I GGTNACC 1 cut(s) 317
EcoO65I GGTNACC 1 cut(s) 317
EcoRV GATATC 1 cut(s) 341
EcoT14I CCWWGG 2 cut(s) 102, 666
EcoT22I ATGCAT 1 cut(s) 660
ErhI CCWWGG 2 cut(s) 102, 666
FaeI CATG 5 cut(s) 22, 106, 398, 662, 712
FaiI YATR 9 cut(s) 20, 104, 141, 170, 249, 396, 600, 660, 710
FatI CATG 5 cut(s) 18, 102, 394, 658, 708
Fnu4HI GCNGC 1 cut(s) 504
FokI GGATG 1 cut(s) 536
Fsp4HI GCNGC 1 cut(s) 504
FspBI CTAG 3 cut(s) 84, 402, 593
GluI GCNGC 1 cut(s) 504
HaeIII GGCC 2 cut(s) 506, 671
HapII CCGG 2 cut(s) 176, 255
Hin1II CATG 5 cut(s) 22, 106, 398, 662, 712
HincII GTYRAC 1 cut(s) 646
HindII GTYRAC 1 cut(s) 646
HindIII AAGCTT 3 cut(s) 11, 111, 569
HinfI GANTC 4 cut(s) 22, 93, 265, 292
HpaII CCGG 2 cut(s) 176, 255
HphI GGTGA 3 cut(s) 54, 260, 667
Hpy166II GTNNAC 5 cut(s) 158, 305, 514, 646, 714
Hpy188III TCNNGA 1 cut(s) 176
Hpy8I GTNNAC 5 cut(s) 158, 305, 514, 646, 714
HpyAV CCTTC 1 cut(s) 687
HpyCH4III ACNGT 1 cut(s) 302
HpyCH4V TGCA 5 cut(s) 4, 195, 350, 580, 658
HpyF10VI GCNNNNNNNGC 4 cut(s) 10, 395, 577, 586
Hsp92II CATG 5 cut(s) 22, 106, 398, 662, 712
Kpn2I TCCGGA 1 cut(s) 175
Kzo9I GATC 2 cut(s) 229, 540
LmnI GCTCC 3 cut(s) 79, 106, 403
LpnPI CCDG 2 cut(s) 189, 268
LweI GCATC 1 cut(s) 68
MaeI CTAG 3 cut(s) 84, 402, 593
MaeIII GTNAC 1 cut(s) 317
MalI GATC 2 cut(s) 231, 542
MboI GATC 2 cut(s) 229, 540
MboII GAAGA 2 cut(s) 51, 550
MluCI AATT 4 cut(s) 72, 179, 274, 582
MlyI GAGTC 1 cut(s) 102
MmeI TCCRAC 1 cut(s) 577
MnlI CCTC 7 cut(s) 56, 255, 323, 326, 444, 450, 568
Mph1103I ATGCAT 1 cut(s) 660
MroI TCCGGA 1 cut(s) 175
MseI TTAA 1 cut(s) 605
MspI CCGG 2 cut(s) 176, 255
MspR9I CCNGG 2 cut(s) 255, 256
MwoI GCNNNNNNNGC 4 cut(s) 10, 395, 577, 586
NciI CCSGG 2 cut(s) 255, 256
NcoI CCATGG 1 cut(s) 102
NdeII GATC 2 cut(s) 229, 540
NlaIII CATG 5 cut(s) 22, 106, 398, 662, 712
NlaIV GGNNCC 1 cut(s) 81
NsiI ATGCAT 1 cut(s) 660
NspI RCATGY 1 cut(s) 712
PciI ACATGT 1 cut(s) 708
PfeI GAWTC 3 cut(s) 22, 265, 292
PkrI GCNGC 1 cut(s) 505
PleI GAGTC 1 cut(s) 101
PpsI GAGTC 1 cut(s) 101
PscI ACATGT 1 cut(s) 708
PsiI TTATAA 1 cut(s) 249
PspEI GGTNACC 1 cut(s) 317
PspN4I GGNNCC 1 cut(s) 81
RsaI GTAC 2 cut(s) 459, 715
RsaNI GTAC 2 cut(s) 458, 714
SaqAI TTAA 1 cut(s) 605
SatI GCNGC 1 cut(s) 504
Sau3AI GATC 2 cut(s) 229, 540
SchI GAGTC 1 cut(s) 102
ScrFI CCNGG 2 cut(s) 255, 256
SfaNI GCATC 1 cut(s) 68
SmaI CCCGGG 1 cut(s) 256
SmlI CTYRAG 1 cut(s) 572
SmoI CTYRAG 1 cut(s) 572
Sse9I AATT 4 cut(s) 72, 179, 274, 582
SsiI CCGC 1 cut(s) 503
SspMI CTAG 3 cut(s) 84, 402, 593
StyD4I CCNGG 2 cut(s) 253, 254
StyI CCWWGG 2 cut(s) 102, 666
TaaI ACNGT 1 cut(s) 302
TasI AATT 4 cut(s) 72, 179, 274, 582
TatI WGTACW 1 cut(s) 713
TauI GCSGC 1 cut(s) 506
TfiI GAWTC 3 cut(s) 22, 265, 292
Tru1I TTAA 1 cut(s) 605
Tru9I TTAA 1 cut(s) 605
TspDTI ATGAA 2 cut(s) 629, 675
TspGWI ACGGA 1 cut(s) 164
TspMI CCCGGG 1 cut(s) 254
XceI RCATGY 1 cut(s) 712
XmaI CCCGGG 1 cut(s) 254
XspI CTAG 3 cut(s) 84, 402, 593
Zsp2I ATGCAT 1 cut(s) 660
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.