Rw3G027860

transposition, RNA-mediated

Design Primers CRISPR Design

Basic Information

Type: gene
Biological Identity
rosa_wichuraiana
Chr3
OG0000437
Physical Location & Seq
Reverse (-)
40441444 .. 40442490
1047 bp
Loading structure...
UTR
Exon/CDS
Intron
Rw3G027860.1

Sequence Viewer

Length: 999 bp
ATGCTTGAAGAAGTTCAACAGGTCAATGATTTCAATTCAAGACCAATGAATGATCCATATTCTAATACATATAACATGAGATGGAAAAATCATCCAAATTTTTCTTGGAGAAACAATCAAGGTGCTGGACCATCACTAAGATCCTATCAATTACCATATCAAGGAACACCGATCAAACCACAAAAGTCCTCGTTTGAGGAAACCTTGAAAGCCTTCAGGTTAAGCCAACAACAACATTCTCAACACTTGTCTAATAATGCCGATACTCTTGCAAGCAAAGTGAACAACCATGGAGCTTCTATCTCTAAGCTTGAAACACAAGTAGGGCAGATAGCTGCCAAATTGAGTGAACGGGAACAAGGCAAATTTCCAAGTCGAGCAGAGATCAATCCGGTGAACCATAAGCCTGTGAATTCAATTACAAATTTGAGAAGTGGTGAAGTGATTGATAATAAAGTGGGAATTCATGAGGAGAACGTGCAACAAGAGAAATTTGCAGTTGGCACACCACAGGATTGTAAGGTTGTATCAATCCCAGAAGAGTCTATCACGGCAGAGGATTCCAAAGACAGTTCCAATCCCCAGAAACATCTTGTTCATAAACAATTATATGTGCCTCCTATCCCCTATCCTCAATGGTTAATGAAGAAGAAGAATGACAAGCACATGATGGACATTTTGGAGATGTTCAAAAAGGAACATATTAACATTCCTCTCCTTGATGCAATAAAACAAATCCCTACATATGCAAAGTTCCTCAAAGATTTGTGCACGAATAAAAGGAATTTTGATGAGCATGAAAAGGTTATGTTGTCTGGGGAAGTGAGTTCAGTGTTACAAAGAAAGATTCCTCCAAAATTGAAGGATCTTGGCAGCTTTTCAATCCCTTGCACTATTGGGGATCATTCTTTCAAGAAAGCTCTGTTAGATTTGGTTATAAGTGTAAACATTATGCCGTACTCTATGTATGAAAAATTGAACTTGGGTGAATTGCAATAA
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families
RVT_1 Retrotrans_gag rve

Protein Analysis

332

Amino Acids

37.89

Weight (kDa)

8.86

Isoelectric Point (pI)

43.76

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready
iTOL Interactive Tree Of Life · Most popular EvolView Flexible annotations MEGA Desktop phylogenetics suite FigTree Desktop tree editor

Orthologous Genes (Group: OG0000437)

Species Orthologous Gene IDs
arabidopsis_thaliana AT2G06105
fragaria_vesca FvH4_1g09709 FvH4_4g02101 FvH4_4g08975 FvH4_6g23372 FvH4_6g39851 FvH4_c1g00300
malus_domestica MD01G1176100.v1.1 MD09G1284900.v1.1 MD15G1306600.v1.1
prunus_persica Prupe.1G227700_v2.0.a1
pyrus_communis pycom01g00630 pycom01g01020 pycom01g01690 pycom01g01760 pycom01g04190 pycom01g04400 pycom02g18130 pycom03g10160 pycom05g06370 pycom05g08930 pycom06g05590 pycom10g06320 pycom11g14330 pycom11g15320 pycom11g16240 pycom12416g00050 pycom12420g00010 pycom12420g00120 pycom12426g00180 pycom12426g00710 pycom12531g00010 pycom1256g00020 pycom1256g00050 pycom1341g00030 pycom1353g00030 pycom13g23070 pycom13g23210 pycom13g26260 pycom13g26370 pycom13g26470 pycom13g26980 pycom14g08550 pycom14g08850 pycom1534g00040 pycom15g28760 pycom15g31230 pycom1604g00040 pycom16g21900 pycom16g26030 pycom1739g00020 pycom1739g00050 pycom17g12970 pycom17g17960 pycom17g18300 pycom17g18650 pycom2172g00020 pycom2438g00020 pycom436g00370 pycom436g00390 pycom576g00050 pycom76g00020
rosa_chinensis RchiOBHm_Chr1g0320811 RchiOBHm_Chr2g0135321 RchiOBHm_Chr3g0485721 RchiOBHm_Chr7g0236571
rosa_multiflora Rmu_sc0000185.1_g000007 Rmu_sc0002094.1_g000030 Rmu_sc0002764.1_g000007 Rmu_sc0002809.1_g000014 Rmu_sc0003005.1_g000007 Rmu_sc0003798.1_g000005 Rmu_sc0004646.1_g000027 Rmu_sc0004665.1_g000009 Rmu_sc0004818.1_g000001 Rmu_sc0004988.1_g000031 Rmu_sc0006373.1_g000007 Rmu_sc0007142.1_g000015 Rmu_sc0009930.1_g000001 Rmu_sc0011451.1_g000001 Rmu_sc0020424.1_g000001 Rmu_sc0036944.1_g000001 Rmu_ssc0000062.1_g000010
rosa_roxburghii Rroxscaffold_2G00123930 Rroxscaffold_3G00231480 Rroxscaffold_6G00413880
rosa_rugosa Rorug04G0084800
rosa_samantha Rh3BG150500 Rh6DG232400
rosa_wichuraiana Rw2G018400 Rw3G027860 Rw4G021220 Rw6G020670 Rw6G037970

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AanI TTATAA 1 cut(s) 938
AclWI GGATC 4 cut(s) 47, 135, 873, 909
AcsI RAATTY 7 cut(s) 97, 365, 412, 424, 462, 491, 784
AcuI CTGAAG 1 cut(s) 199
AfaI GTAC 1 cut(s) 959
AfiI CCNNNNNNNGG 1 cut(s) 161
AluBI AGCT 5 cut(s) 296, 310, 335, 876, 920
AluI AGCT 5 cut(s) 296, 310, 335, 876, 920
Alw21I GWGCWC 1 cut(s) 773
Alw44I GTGCAC 1 cut(s) 769
AlwI GGATC 4 cut(s) 47, 135, 873, 909
ApaLI GTGCAC 1 cut(s) 769
ApeKI GCWGC 2 cut(s) 335, 873
ApoI RAATTY 7 cut(s) 97, 365, 412, 424, 462, 491, 784
Asp700I GAANNNNTTC 2 cut(s) 12, 212
AspS9I GGNCC 1 cut(s) 128
AsuHPI GGTGA 3 cut(s) 406, 449, 998
AvaII GGWCC 1 cut(s) 128
BaeGI GKGCMC 1 cut(s) 773
Bbv12I GWGCWC 1 cut(s) 773
BbvI GCAGC 2 cut(s) 322, 885
BccI CCATC 3 cut(s) 75, 139, 664
BceAI ACGGC 2 cut(s) 567, 940
BcgI CGANNNNNNTGC 2 cut(s) 251, 285
BisI GCNGC 2 cut(s) 336, 874
BlsI GCNGC 2 cut(s) 337, 875
Bme18I GGWCC 1 cut(s) 128
BmgT120I GGNCC 1 cut(s) 128
BmsI GCATC 1 cut(s) 712
BsaJI CCNNGG 1 cut(s) 289
BsaWI WCCGGW 1 cut(s) 391
Bsc4I CCNNNNNNNGG 1 cut(s) 161
BseDI CCNNGG 1 cut(s) 289
BseGI GGATG 1 cut(s) 91
BseLI CCNNNNNNNGG 1 cut(s) 161
BseRI GAGGAG 1 cut(s) 485
BseSI GKGCMC 1 cut(s) 773
BseXI GCAGC 2 cut(s) 322, 885
BsiHKAI GWGCWC 1 cut(s) 773
BsiSI CCGG 1 cut(s) 392
BslI CCNNNNNNNGG 1 cut(s) 161
Bsp1286I GDGCHC 1 cut(s) 773
Bsp143I GATC 6 cut(s) 52, 140, 171, 384, 865, 901
Bsp19I CCATGG 1 cut(s) 289
BspHI TCATGA 1 cut(s) 466
BspPI GGATC 4 cut(s) 47, 135, 873, 909
BssECI CCNNGG 1 cut(s) 289
BssMI GATC 6 cut(s) 52, 140, 171, 384, 865, 901
BssT1I CCWWGG 1 cut(s) 289
Bst4CI ACNGT 1 cut(s) 572
Bst6I CTCTTC 1 cut(s) 534
BstC8I GCNNGC 1 cut(s) 274
BstDEI CTNAG 2 cut(s) 137, 306
BstDSI CCRYGG 1 cut(s) 289
BstF5I GGATG 1 cut(s) 91
BstKTI GATC 6 cut(s) 55, 143, 174, 387, 868, 904
BstMBI GATC 6 cut(s) 52, 140, 171, 384, 865, 901
BstSLI GKGCMC 1 cut(s) 773
BstV1I GCAGC 2 cut(s) 322, 885
BstX2I RGATCY 2 cut(s) 140, 865
BstYI RGATCY 2 cut(s) 140, 865
BtgI CCRYGG 1 cut(s) 289
BtsCI GGATG 1 cut(s) 91
BtsIMutI CAGTG 1 cut(s) 837
Cac8I GCNNGC 1 cut(s) 274
CciI TCATGA 1 cut(s) 466
Cfr13I GGNCC 1 cut(s) 128
Csp6I GTAC 1 cut(s) 958
CviAII CATG 5 cut(s) 76, 290, 467, 667, 797
CviJI RGCY 8 cut(s) 212, 225, 296, 310, 335, 406, 876, 920
CviKI_1 RGCY 8 cut(s) 212, 225, 296, 310, 335, 406, 876, 920
CviQI GTAC 1 cut(s) 958
DdeI CTNAG 2 cut(s) 137, 306
DpnI GATC 6 cut(s) 54, 142, 173, 386, 867, 903
DpnII GATC 6 cut(s) 52, 140, 171, 384, 865, 901
Eam1104I CTCTTC 1 cut(s) 534
EarI CTCTTC 1 cut(s) 534
Eco130I CCWWGG 1 cut(s) 289
Eco47I GGWCC 1 cut(s) 128
Eco57I CTGAAG 1 cut(s) 199
EcoRI GAATTC 2 cut(s) 412, 462
EcoT14I CCWWGG 1 cut(s) 289
ErhI CCWWGG 1 cut(s) 289
FaeI CATG 5 cut(s) 79, 293, 470, 670, 800
FatI CATG 5 cut(s) 75, 289, 466, 666, 796
FauNDI CATATG 1 cut(s) 745
Fnu4HI GCNGC 2 cut(s) 336, 874
FokI GGATG 1 cut(s) 78
Fsp4HI GCNGC 2 cut(s) 336, 874
GluI GCNGC 2 cut(s) 336, 874
HapII CCGG 1 cut(s) 392
Hin1II CATG 5 cut(s) 79, 293, 470, 670, 800
HindIII AAGCTT 1 cut(s) 308
HinfI GANTC 3 cut(s) 542, 560, 847
HpaII CCGG 1 cut(s) 392
HphI GGTGA 3 cut(s) 406, 449, 998
Hpy166II GTNNAC 5 cut(s) 283, 350, 397, 771, 946
Hpy188III TCNNGA 3 cut(s) 39, 467, 913
Hpy8I GTNNAC 5 cut(s) 283, 350, 397, 771, 946
HpyAV CCTTC 2 cut(s) 223, 856
HpyCH4III ACNGT 1 cut(s) 572
HpyCH4IV ACGT 1 cut(s) 477
HpyCH4V TGCA 8 cut(s) 272, 481, 497, 725, 749, 771, 891, 994
HpyF3I CTNAG 2 cut(s) 137, 306
HpySE526I ACGT 1 cut(s) 477
Hsp92II CATG 5 cut(s) 79, 293, 470, 670, 800
Kzo9I GATC 6 cut(s) 52, 140, 171, 384, 865, 901
LmnI GCTCC 1 cut(s) 293
LpnPI CCDG 9 cut(s) 5, 111, 202, 405, 420, 497, 549, 596, 801
Lsp1109I GCAGC 2 cut(s) 322, 885
LweI GCATC 1 cut(s) 712
MaeII ACGT 1 cut(s) 477
MaeIII GTNAC 1 cut(s) 834
MalI GATC 6 cut(s) 54, 142, 173, 386, 867, 903
MboI GATC 6 cut(s) 52, 140, 171, 384, 865, 901
MboII GAAGA 5 cut(s) 20, 551, 658, 661, 664
MflI RGATCY 2 cut(s) 140, 865
MhlI GDGCHC 1 cut(s) 773
MlyI GAGTC 1 cut(s) 551
MnlI CCTC 9 cut(s) 190, 199, 463, 550, 627, 642, 723, 767, 861
MroXI GAANNNNTTC 2 cut(s) 12, 212
MseI TTAA 3 cut(s) 221, 641, 705
MspI CCGG 1 cut(s) 392
NcoI CCATGG 1 cut(s) 289
NdeI CATATG 1 cut(s) 745
NdeII GATC 6 cut(s) 52, 140, 171, 384, 865, 901
NlaIII CATG 5 cut(s) 79, 293, 470, 670, 800
PagI TCATGA 1 cut(s) 466
PdmI GAANNNNTTC 2 cut(s) 12, 212
PfeI GAWTC 2 cut(s) 560, 847
PkrI GCNGC 2 cut(s) 337, 875
PleI GAGTC 1 cut(s) 550
PpsI GAGTC 1 cut(s) 550
PsiI TTATAA 1 cut(s) 938
PspPI GGNCC 1 cut(s) 128
PsuI RGATCY 2 cut(s) 140, 865
RsaI GTAC 1 cut(s) 959
RsaNI GTAC 1 cut(s) 958
SaqAI TTAA 3 cut(s) 221, 641, 705
SatI GCNGC 2 cut(s) 336, 874
Sau3AI GATC 6 cut(s) 52, 140, 171, 384, 865, 901
Sau96I GGNCC 1 cut(s) 128
SchI GAGTC 1 cut(s) 551
SduI GDGCHC 1 cut(s) 773
SfaNI GCATC 1 cut(s) 712
SinI GGWCC 1 cut(s) 128
StyI CCWWGG 1 cut(s) 289
TaaI ACNGT 1 cut(s) 572
TaiI ACGT 1 cut(s) 480
TaqI TCGA 1 cut(s) 376
TfiI GAWTC 2 cut(s) 560, 847
Tru1I TTAA 3 cut(s) 221, 641, 705
Tru9I TTAA 3 cut(s) 221, 641, 705
TscAI CASTG 1 cut(s) 837
TseI GCWGC 2 cut(s) 335, 873
TspDTI ATGAA 6 cut(s) 62, 455, 587, 659, 813, 984
TspRI CASTG 1 cut(s) 837
VneI GTGCAC 1 cut(s) 769
VpaK11BI GGWCC 1 cut(s) 128
XapI RAATTY 7 cut(s) 97, 365, 412, 424, 462, 491, 784
XcmI CCANNNNNNNNNTGG 1 cut(s) 102
XmnI GAANNNNTTC 2 cut(s) 12, 212
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.