Rmu_sc0007142.1_g000015

protein kinase activity

Basic Information

Type: gene
Biological Identity
rosa_multiflora
Rmu_sc0007142.1
Physical Location & Seq
Forward (+)
33408 .. 34103
696 bp
Loading structure...
UTR
Exon/CDS
Intron
Rmu_sc0007142.1_g000015.1.cds

Sequence Viewer

Length: 696 bp
atggacaagtacaatgaggatggaatgaagcttatagcagatcgtgcattaaatgcacaacaattcaataatacctcaagacgtgttcaaactttctcttcaaaaggaggtaacgattctgaaattaaggctcaattatcaaatctaacctctatgttatctcaggtcttgggtaacaagaagcaaggagctgcagcttgtggtgtgtgctcaatggaaggccaccatactgatcgttgccctcaattatatgaggaagaagaggtacaagtggtgggaaattttcagcaaggaggacaacatgtaaagaatgatccatatgcatattatcctggctcaagaaatcacccaaattttcggtggagtaacaatgataatgtcttgggcccttttcaagcatctcaaagcaacaaccgtccacctccagggttcactcaacgtcctcaagggggatttacatatagccctgcgccacatcaagcttctagttcttcaatgactccaatcttggataagtatgacaagatgttcgaagctttgacattctctactcaacaactcattcaatcacagcaaaatcaaggcaaggaaatttcagaccttaagaaacaagtgggagaatgtgtcaacaagttgagtcagttggcaagggaagcttccaagccaaacaattccaaatccgaaggctcgatatga
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.

Protein Analysis

231

Amino Acids

25.57

Weight (kDa)

8.29

Isoelectric Point (pI)

53.85

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Orthologous Genes (Group: OG0000437)

Species Orthologous Gene IDs
arabidopsis_thaliana AT2G06105
fragaria_vesca FvH4_1g09709 FvH4_4g02101 FvH4_4g08975 FvH4_6g23372 FvH4_6g39851 FvH4_c1g00300
malus_domestica MD01G1176100.v1.1 MD09G1284900.v1.1 MD15G1306600.v1.1
prunus_persica Prupe.1G227700_v2.0.a1
pyrus_communis pycom01g00630 pycom01g01020 pycom01g01690 pycom01g01760 pycom01g04190 pycom01g04400 pycom02g18130 pycom03g10160 pycom05g06370 pycom05g08930 pycom06g05590 pycom10g06320 pycom11g14330 pycom11g15320 pycom11g16240 pycom12416g00050 pycom12420g00010 pycom12420g00120 pycom12426g00180 pycom12426g00710 pycom12531g00010 pycom1256g00020 pycom1256g00050 pycom1341g00030 pycom1353g00030 pycom13g23070 pycom13g23210 pycom13g26260 pycom13g26370 pycom13g26470 pycom13g26980 pycom14g08550 pycom14g08850 pycom1534g00040 pycom15g28760 pycom15g31230 pycom1604g00040 pycom16g21900 pycom16g26030 pycom1739g00020 pycom1739g00050 pycom17g12970 pycom17g17960 pycom17g18300 pycom17g18650 pycom2172g00020 pycom2438g00020 pycom436g00370 pycom436g00390 pycom576g00050 pycom76g00020
rosa_chinensis RchiOBHm_Chr1g0320811 RchiOBHm_Chr2g0135321 RchiOBHm_Chr3g0485721 RchiOBHm_Chr7g0236571
rosa_multiflora Rmu_sc0000185.1_g000007 Rmu_sc0002094.1_g000030 Rmu_sc0002764.1_g000007 Rmu_sc0002809.1_g000014 Rmu_sc0003005.1_g000007 Rmu_sc0003798.1_g000005 Rmu_sc0004646.1_g000027 Rmu_sc0004665.1_g000009 Rmu_sc0004818.1_g000001 Rmu_sc0004988.1_g000031 Rmu_sc0006373.1_g000007 Rmu_sc0007142.1_g000015 Rmu_sc0009930.1_g000001 Rmu_sc0011451.1_g000001 Rmu_sc0020424.1_g000001 Rmu_sc0036944.1_g000001 Rmu_ssc0000062.1_g000010
rosa_roxburghii Rroxscaffold_2G00123930 Rroxscaffold_3G00231480 Rroxscaffold_6G00413880
rosa_rugosa Rorug04G0084800
rosa_samantha Rh3BG150500 Rh6DG232400
rosa_wichuraiana Rw2G018400 Rw3G027860 Rw4G021220 Rw6G020670 Rw6G037970

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AclWI GGATC 1 cut(s) 308
AcsI RAATTY 3 cut(s) 280, 352, 591
AfaI GTAC 2 cut(s) 11, 267
AfiI CCNNNNNNNGG 2 cut(s) 425, 449
AflII CTTAAG 1 cut(s) 602
AflIII ACRYGT 2 cut(s) 82, 301
AgsI TTSAA 6 cut(s) 67, 89, 102, 395, 495, 566
AjiI CACGTC 1 cut(s) 83
AjnI CCWGG 2 cut(s) 331, 424
AluBI AGCT 6 cut(s) 31, 191, 197, 482, 536, 656
AluI AGCT 6 cut(s) 31, 191, 197, 482, 536, 656
Alw21I GWGCWC 1 cut(s) 212
AlwI GGATC 1 cut(s) 308
AoxI GGCC 2 cut(s) 220, 385
ApaI GGGCCC 1 cut(s) 389
ApeKI GCWGC 2 cut(s) 191, 194
ApoI RAATTY 3 cut(s) 280, 352, 591
ArsI GACNNNNNNTTYG 2 cut(s) 512, 544
AspLEI GCGC 1 cut(s) 472
AspS9I GGNCC 2 cut(s) 385, 386
AsuHPI GGTGA 1 cut(s) 338
AsuII TTCGAA 1 cut(s) 531
BaeGI GKGCMC 1 cut(s) 389
BanII GRGCYC 1 cut(s) 389
BarI GAAGNNNNNNTAC 2 cut(s) 249, 281
Bbv12I GWGCWC 1 cut(s) 212
BbvI GCAGC 2 cut(s) 178, 206
BccI CCATC 1 cut(s) 14
BciT130I CCWGG 2 cut(s) 333, 426
BfaI CTAG 1 cut(s) 486
BfmI CTRYAG 1 cut(s) 192
BfrI CTTAAG 1 cut(s) 602
BisI GCNGC 2 cut(s) 192, 195
BlsI GCNGC 2 cut(s) 193, 196
Bme1390I CCNGG 2 cut(s) 333, 426
BmgBI CACGTC 1 cut(s) 83
BmgT120I GGNCC 2 cut(s) 385, 386
BmiI GGNNCC 1 cut(s) 387
BmrFI CCNGG 2 cut(s) 333, 426
BmsI GCATC 1 cut(s) 407
BpmI CTGGAG 1 cut(s) 408
Bpu14I TTCGAA 1 cut(s) 531
BpuEI CTTGAG 3 cut(s) 61, 322, 429
BsaJI CCNNGG 1 cut(s) 425
BsaXI ACNNNNNCTCC 2 cut(s) 609, 639
Bsc4I CCNNNNNNNGG 2 cut(s) 425, 449
BseBI CCWGG 2 cut(s) 333, 426
BseDI CCNNGG 1 cut(s) 425
BseGI GGATG 1 cut(s) 25
BseLI CCNNNNNNNGG 2 cut(s) 425, 449
BseMII CTCAG 1 cut(s) 176
BseSI GKGCMC 1 cut(s) 389
BseXI GCAGC 2 cut(s) 178, 206
BshFI GGCC 2 cut(s) 222, 387
BsiHKAI GWGCWC 1 cut(s) 212
BslI CCNNNNNNNGG 2 cut(s) 425, 449
BsnI GGCC 2 cut(s) 222, 387
Bsp119I TTCGAA 1 cut(s) 531
Bsp120I GGGCCC 1 cut(s) 385
Bsp1286I GDGCHC 2 cut(s) 212, 389
Bsp143I GATC 3 cut(s) 40, 232, 313
BspANI GGCC 2 cut(s) 222, 387
BspCNI CTCAG 1 cut(s) 175
BspLI GGNNCC 1 cut(s) 387
BspMAI CTGCAG 1 cut(s) 196
BspPI GGATC 1 cut(s) 308
BspT104I TTCGAA 1 cut(s) 531
BspTI CTTAAG 1 cut(s) 602
BssECI CCNNGG 1 cut(s) 425
BssMI GATC 3 cut(s) 40, 232, 313
Bst2UI CCWGG 2 cut(s) 333, 426
Bst4CI ACNGT 1 cut(s) 416
Bst6I CTCTTC 2 cut(s) 103, 255
BstAFI CTTAAG 1 cut(s) 602
BstAPI GCANNNNNTGC 2 cut(s) 44, 53
BstBI TTCGAA 1 cut(s) 531
BstDEI CTNAG 1 cut(s) 162
BstF5I GGATG 1 cut(s) 25
BstHHI GCGC 1 cut(s) 472
BstKTI GATC 3 cut(s) 43, 235, 316
BstMBI GATC 3 cut(s) 40, 232, 313
BstMWI GCNNNNNNNGC 3 cut(s) 44, 53, 653
BstNI CCWGG 2 cut(s) 333, 426
BstNSI RCATGY 1 cut(s) 305
BstSCI CCNGG 2 cut(s) 331, 424
BstSFI CTRYAG 1 cut(s) 192
BstSLI GKGCMC 1 cut(s) 389
BstV1I GCAGC 2 cut(s) 178, 206
BsuRI GGCC 2 cut(s) 222, 387
BtrI CACGTC 1 cut(s) 83
BtsCI GGATG 1 cut(s) 25
CfoI GCGC 1 cut(s) 472
Cfr13I GGNCC 2 cut(s) 385, 386
Csp6I GTAC 2 cut(s) 10, 266
CviAII CATG 1 cut(s) 302
CviQI GTAC 2 cut(s) 10, 266
DdeI CTNAG 1 cut(s) 162
DpnI GATC 3 cut(s) 42, 234, 315
DpnII GATC 3 cut(s) 40, 232, 313
Eam1104I CTCTTC 2 cut(s) 103, 255
EarI CTCTTC 2 cut(s) 103, 255
Eco24I GRGCYC 1 cut(s) 389
EcoO109I RGGNCCY 1 cut(s) 386
EcoRII CCWGG 2 cut(s) 331, 424
EcoT22I ATGCAT 1 cut(s) 325
EcoT38I GRGCYC 1 cut(s) 389
FaeI CATG 1 cut(s) 305
FalI AAGNNNNNCTT 2 cut(s) 640, 672
FatI CATG 1 cut(s) 301
FauNDI CATATG 1 cut(s) 319
Fnu4HI GCNGC 2 cut(s) 192, 195
FokI GGATG 1 cut(s) 32
FriOI GRGCYC 1 cut(s) 389
Fsp4HI GCNGC 2 cut(s) 192, 195
FspBI CTAG 1 cut(s) 486
GlaI GCGC 1 cut(s) 471
GluI GCNGC 2 cut(s) 192, 195
GsuI CTGGAG 1 cut(s) 408
HaeIII GGCC 2 cut(s) 222, 387
HhaI GCGC 1 cut(s) 472
Hin1II CATG 1 cut(s) 305
Hin6I GCGC 1 cut(s) 470
HinP1I GCGC 1 cut(s) 470
HincII GTYRAC 1 cut(s) 628
HindII GTYRAC 1 cut(s) 628
HindIII AAGCTT 4 cut(s) 29, 480, 534, 654
HinfI GANTC 3 cut(s) 116, 499, 637
HphI GGTGA 1 cut(s) 338
Hpy166II GTNNAC 3 cut(s) 419, 432, 628
Hpy188I TCNGA 3 cut(s) 121, 598, 682
Hpy188III TCNNGA 2 cut(s) 78, 339
Hpy8I GTNNAC 3 cut(s) 419, 432, 628
HpyAV CCTTC 2 cut(s) 212, 677
HpyCH4III ACNGT 1 cut(s) 416
HpyCH4IV ACGT 2 cut(s) 82, 439
HpyCH4V TGCA 4 cut(s) 47, 56, 194, 323
HpyF10VI GCNNNNNNNGC 3 cut(s) 44, 53, 653
HpyF3I CTNAG 1 cut(s) 162
HpySE526I ACGT 2 cut(s) 82, 439
Hsp92II CATG 1 cut(s) 305
HspAI GCGC 1 cut(s) 470
Kzo9I GATC 3 cut(s) 40, 232, 313
LmnI GCTCC 1 cut(s) 188
LpnPI CCDG 6 cut(s) 149, 318, 345, 411, 438, 480
Lsp1109I GCAGC 2 cut(s) 178, 206
LweI GCATC 1 cut(s) 407
MaeI CTAG 1 cut(s) 486
MaeII ACGT 2 cut(s) 82, 439
MaeIII GTNAC 3 cut(s) 110, 173, 365
MalI GATC 3 cut(s) 42, 234, 315
MboI GATC 3 cut(s) 40, 232, 313
MboII GAAGA 4 cut(s) 90, 269, 272, 483
MhlI GDGCHC 2 cut(s) 212, 389
MluCI AATT 8 cut(s) 62, 123, 134, 245, 280, 352, 591, 670
MlyI GAGTC 2 cut(s) 493, 646
Mph1103I ATGCAT 1 cut(s) 325
MseI TTAA 3 cut(s) 50, 126, 603
MspCI CTTAAG 1 cut(s) 602
MspR9I CCNGG 2 cut(s) 333, 426
MvaI CCWGG 2 cut(s) 333, 426
MwoI GCNNNNNNNGC 3 cut(s) 44, 53, 653
NdeI CATATG 1 cut(s) 319
NdeII GATC 3 cut(s) 40, 232, 313
NlaIII CATG 1 cut(s) 305
NlaIV GGNNCC 1 cut(s) 387
NsiI ATGCAT 1 cut(s) 325
NspI RCATGY 1 cut(s) 305
NspV TTCGAA 1 cut(s) 531
PciI ACATGT 1 cut(s) 301
PfeI GAWTC 1 cut(s) 116
PkrI GCNGC 2 cut(s) 193, 196
PleI GAGTC 2 cut(s) 493, 645
PpsI GAGTC 2 cut(s) 493, 645
PscI ACATGT 1 cut(s) 301
Psp6I CCWGG 2 cut(s) 331, 424
PspGI CCWGG 2 cut(s) 331, 424
PspN4I GGNNCC 1 cut(s) 387
PspOMI GGGCCC 1 cut(s) 385
PspPI GGNCC 2 cut(s) 385, 386
PstI CTGCAG 1 cut(s) 196
RsaI GTAC 2 cut(s) 11, 267
RsaNI GTAC 2 cut(s) 10, 266
SaqAI TTAA 3 cut(s) 50, 126, 603
SatI GCNGC 2 cut(s) 192, 195
Sau3AI GATC 3 cut(s) 40, 232, 313
Sau96I GGNCC 2 cut(s) 385, 386
SchI GAGTC 2 cut(s) 493, 646
ScrFI CCNGG 2 cut(s) 333, 426
SduI GDGCHC 2 cut(s) 212, 389
SfaNI GCATC 1 cut(s) 407
SfcI CTRYAG 1 cut(s) 192
SfuI TTCGAA 1 cut(s) 531
SmlI CTYRAG 4 cut(s) 76, 337, 444, 602
SmoI CTYRAG 4 cut(s) 76, 337, 444, 602
Sse9I AATT 8 cut(s) 62, 123, 134, 245, 280, 352, 591, 670
SspMI CTAG 1 cut(s) 486
StyD4I CCNGG 2 cut(s) 331, 424
TaaI ACNGT 1 cut(s) 416
TaiI ACGT 2 cut(s) 85, 442
TaqI TCGA 2 cut(s) 531, 689
TasI AATT 8 cut(s) 62, 123, 134, 245, 280, 352, 591, 670
TatI WGTACW 1 cut(s) 9
TfiI GAWTC 1 cut(s) 116
Tru1I TTAA 3 cut(s) 50, 126, 603
Tru9I TTAA 3 cut(s) 50, 126, 603
TseI GCWGC 2 cut(s) 191, 194
TspDTI ATGAA 1 cut(s) 41
Vha464I CTTAAG 1 cut(s) 602
XapI RAATTY 3 cut(s) 280, 352, 591
XceI RCATGY 1 cut(s) 305
XcmI CCANNNNNNNNNTGG 1 cut(s) 357
XspI CTAG 1 cut(s) 486
Zsp2I ATGCAT 1 cut(s) 325
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.