Rmu_sc0020424.1_g000001

Aspartyl protease

Design Primers CRISPR Design

Basic Information

Type: gene
Biological Identity
rosa_multiflora
Rmu_sc0020424.1
OG0000437
Physical Location & Seq
Forward (+)
25 .. 1094
1070 bp
Loading structure...
UTR
Exon/CDS
Intron
Rmu_sc0020424.1_g000001.1.cds

Sequence Viewer

Length: 1070 bp
atggcatcaccaagccaaattcgggagcctagtttgggagtcaaatccatggagcaaacttgcttgatttacgaaagtgtgtaccatagcacaacggagtgttcacaaagcgacatgtacctggaattgatagagcaatgcaatcttctcagcaaccaaacaaggccaaagaatgatccttatagcaacacttataatcccgggtggaggaatcaccctaattttggttggggcgggaatcaaaaccgtgaacaaggtcaaggttaccaaaggcaaggaggtggctatcaaggtgcaagtagctcacacttcaacaatcaaggagcaaacaatgcttatcatgctcctagaccaccttatcaagcaccacctcaacaacctctacctctacaacaaccccaagtgccaattcaagaagcaagaaagacacctacccttgaagaaatgataacggcctttgtgaataatcaagcaaagcaagatgagaagatcaatgtcattcaacaaagtgtgagcaagcttgaggtacaaatggggcaactagctagtgagttaagtcaaagaaggcaaggtgtgtttccatgccaattggagacaaacccaagacatgaagccaaagctattaccaccttgagaagtggaaggcaagtggagaacaatgtgtacatgcctaccaataaggaagatgtaactccaagggagccacccggttttgaaagaagatcaaaggggaaagcaagagagttgtcacatggagaagtcatcttaggcttcaatgatggtgaagaagaagctttgaatgataagaagaatccttatgccgatgagaagcaagaagaagccttgaaggacaatttcaatgccaaggttggaactcatgataatgaagactctcattctactctaattgaaaggccattcaaaagaggtatgaccttcaatcctcctttgaagattgtgcaagatgaagaagtgtctctcccttaccttcaagctatatggcaacaagacaaaaaactcaagaaagagagccaattgagggagatgattgatttgttcaagaaggttca
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families
No domains found.

Protein Analysis

356

Amino Acids

40.55

Weight (kDa)

6.13

Isoelectric Point (pI)

55.87

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready
iTOL Interactive Tree Of Life · Most popular EvolView Flexible annotations MEGA Desktop phylogenetics suite FigTree Desktop tree editor

Orthologous Genes (Group: OG0000437)

Species Orthologous Gene IDs
arabidopsis_thaliana AT2G06105
fragaria_vesca FvH4_1g09709 FvH4_4g02101 FvH4_4g08975 FvH4_6g23372 FvH4_6g39851 FvH4_c1g00300
malus_domestica MD01G1176100.v1.1 MD09G1284900.v1.1 MD15G1306600.v1.1
prunus_persica Prupe.1G227700_v2.0.a1
pyrus_communis pycom01g00630 pycom01g01020 pycom01g01690 pycom01g01760 pycom01g04190 pycom01g04400 pycom02g18130 pycom03g10160 pycom05g06370 pycom05g08930 pycom06g05590 pycom10g06320 pycom11g14330 pycom11g15320 pycom11g16240 pycom12416g00050 pycom12420g00010 pycom12420g00120 pycom12426g00180 pycom12426g00710 pycom12531g00010 pycom1256g00020 pycom1256g00050 pycom1341g00030 pycom1353g00030 pycom13g23070 pycom13g23210 pycom13g26260 pycom13g26370 pycom13g26470 pycom13g26980 pycom14g08550 pycom14g08850 pycom1534g00040 pycom15g28760 pycom15g31230 pycom1604g00040 pycom16g21900 pycom16g26030 pycom1739g00020 pycom1739g00050 pycom17g12970 pycom17g17960 pycom17g18300 pycom17g18650 pycom2172g00020 pycom2438g00020 pycom436g00370 pycom436g00390 pycom576g00050 pycom76g00020
rosa_chinensis RchiOBHm_Chr1g0320811 RchiOBHm_Chr2g0135321 RchiOBHm_Chr3g0485721 RchiOBHm_Chr7g0236571
rosa_multiflora Rmu_sc0000185.1_g000007 Rmu_sc0002094.1_g000030 Rmu_sc0002764.1_g000007 Rmu_sc0002809.1_g000014 Rmu_sc0003005.1_g000007 Rmu_sc0003798.1_g000005 Rmu_sc0004646.1_g000027 Rmu_sc0004665.1_g000009 Rmu_sc0004818.1_g000001 Rmu_sc0004988.1_g000031 Rmu_sc0006373.1_g000007 Rmu_sc0007142.1_g000015 Rmu_sc0009930.1_g000001 Rmu_sc0011451.1_g000001 Rmu_sc0020424.1_g000001 Rmu_sc0036944.1_g000001 Rmu_ssc0000062.1_g000010
rosa_roxburghii Rroxscaffold_2G00123930 Rroxscaffold_3G00231480 Rroxscaffold_6G00413880
rosa_rugosa Rorug04G0084800
rosa_samantha Rh3BG150500 Rh6DG232400
rosa_wichuraiana Rw2G018400 Rw3G027860 Rw4G021220 Rw6G020670 Rw6G037970

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AanI TTATAA 1 cut(s) 195
AciI CCGC 1 cut(s) 234
AclWI GGATC 1 cut(s) 170
AcsI RAATTY 1 cut(s) 18
AfaI GTAC 4 cut(s) 83, 119, 528, 665
AfiI CCNNNNNNNGG 5 cut(s) 22, 35, 207, 224, 1039
AflIII ACRYGT 1 cut(s) 114
AjnI CCWGG 1 cut(s) 120
AjuI GAANNNNNNNTTGG 2 cut(s) 393, 425
AluBI AGCT 6 cut(s) 303, 520, 545, 620, 794, 995
AluI AGCT 6 cut(s) 303, 520, 545, 620, 794, 995
Alw26I GTCTC 2 cut(s) 587, 981
AlwI GGATC 1 cut(s) 170
Ama87I CYCGRG 1 cut(s) 200
AoxI GGCC 3 cut(s) 164, 453, 914
ApoI RAATTY 1 cut(s) 18
AsuC2I CCSGG 3 cut(s) 201, 202, 708
AsuHPI GGTGA 2 cut(s) 206, 794
AvaI CYCGRG 1 cut(s) 200
BbsI GAAGAC 1 cut(s) 894
BccI CCATC 1 cut(s) 773
BceAI ACGGC 1 cut(s) 468
BciT130I CCWGG 1 cut(s) 122
BcnI CCSGG 3 cut(s) 201, 202, 708
BcoDI GTCTC 2 cut(s) 587, 981
BfaI CTAG 4 cut(s) 30, 348, 542, 546
Bme1390I CCNGG 4 cut(s) 122, 201, 202, 708
BmeT110I CYCGRG 1 cut(s) 200
BmiI GGNNCC 2 cut(s) 27, 702
BmrFI CCNGG 4 cut(s) 122, 201, 202, 708
BmsI GCATC 1 cut(s) 14
BpiI GAAGAC 1 cut(s) 894
BpuEI CTTGAG 3 cut(s) 542, 652, 1004
BpuMI CCSGG 3 cut(s) 201, 202, 708
BsaJI CCNNGG 4 cut(s) 48, 200, 695, 864
Bsc4I CCNNNNNNNGG 5 cut(s) 22, 35, 207, 224, 1039
Bse3DI GCAATG 1 cut(s) 143
BseBI CCWGG 1 cut(s) 122
BseDI CCNNGG 4 cut(s) 48, 200, 695, 864
BseLI CCNNNNNNNGG 5 cut(s) 22, 35, 207, 224, 1039
BseMI GCAATG 1 cut(s) 143
BseMII CTCAG 1 cut(s) 163
BshFI GGCC 3 cut(s) 166, 455, 916
BsiHKCI CYCGRG 1 cut(s) 200
BsiSI CCGG 2 cut(s) 201, 708
BslI CCNNNNNNNGG 5 cut(s) 22, 35, 207, 224, 1039
BsmAI GTCTC 2 cut(s) 587, 981
BsnI GGCC 3 cut(s) 166, 455, 916
BsoBI CYCGRG 1 cut(s) 200
Bsp1407I TGTACA 1 cut(s) 663
Bsp143I GATC 3 cut(s) 175, 489, 722
Bsp19I CCATGG 1 cut(s) 48
BspACI CCGC 1 cut(s) 234
BspANI GGCC 3 cut(s) 166, 455, 916
BspCNI CTCAG 1 cut(s) 162
BspHI TCATGA 1 cut(s) 877
BspLI GGNNCC 2 cut(s) 27, 702
BspPI GGATC 1 cut(s) 170
BsrDI GCAATG 1 cut(s) 143
BsrGI TGTACA 1 cut(s) 663
BssECI CCNNGG 4 cut(s) 48, 200, 695, 864
BssMI GATC 3 cut(s) 175, 489, 722
BssT1I CCWWGG 3 cut(s) 48, 695, 864
Bst2UI CCWGG 1 cut(s) 122
Bst4CI ACNGT 1 cut(s) 248
BstAPI GCANNNNNTGC 1 cut(s) 332
BstAUI TGTACA 1 cut(s) 663
BstC8I GCNNGC 1 cut(s) 518
BstDEI CTNAG 2 cut(s) 149, 766
BstDSI CCRYGG 1 cut(s) 48
BstEII GGTNACC 1 cut(s) 263
BstKTI GATC 3 cut(s) 178, 492, 725
BstMAI GTCTC 2 cut(s) 587, 981
BstMBI GATC 3 cut(s) 175, 489, 722
BstMWI GCNNNNNNNGC 2 cut(s) 332, 341
BstNI CCWGG 1 cut(s) 122
BstNSI RCATGY 2 cut(s) 118, 670
BstPI GGTNACC 1 cut(s) 263
BstSCI CCNGG 4 cut(s) 120, 199, 200, 706
BstV2I GAAGAC 1 cut(s) 894
BsuRI GGCC 3 cut(s) 166, 455, 916
BtgI CCRYGG 1 cut(s) 48
Cac8I GCNNGC 1 cut(s) 518
CciI TCATGA 1 cut(s) 877
Cfr9I CCCGGG 1 cut(s) 200
Csp6I GTAC 4 cut(s) 82, 118, 527, 664
CviAII CATG 8 cut(s) 49, 115, 341, 582, 608, 667, 752, 878
CviQI GTAC 4 cut(s) 82, 118, 527, 664
DdeI CTNAG 2 cut(s) 149, 766
DpnI GATC 3 cut(s) 177, 491, 724
DpnII GATC 3 cut(s) 175, 489, 722
Eco130I CCWWGG 3 cut(s) 48, 695, 864
Eco88I CYCGRG 1 cut(s) 200
Eco91I GGTNACC 1 cut(s) 263
EcoO65I GGTNACC 1 cut(s) 263
EcoRII CCWGG 1 cut(s) 120
EcoT14I CCWWGG 3 cut(s) 48, 695, 864
ErhI CCWWGG 3 cut(s) 48, 695, 864
FaeI CATG 8 cut(s) 52, 118, 344, 585, 611, 670, 755, 881
FatI CATG 8 cut(s) 48, 114, 340, 581, 607, 666, 751, 877
FauI CCCGC 1 cut(s) 227
FspBI CTAG 4 cut(s) 30, 348, 542, 546
HaeIII GGCC 3 cut(s) 166, 455, 916
HapII CCGG 2 cut(s) 201, 708
Hin1II CATG 8 cut(s) 52, 118, 344, 585, 611, 670, 755, 881
HindIII AAGCTT 2 cut(s) 518, 792
HinfI GANTC 5 cut(s) 39, 211, 238, 811, 890
HpaII CCGG 2 cut(s) 201, 708
HphI GGTGA 2 cut(s) 206, 794
Hpy166II GTNNAC 4 cut(s) 82, 104, 251, 664
Hpy188III TCNNGA 5 cut(s) 23, 413, 878, 1021, 1060
Hpy8I GTNNAC 4 cut(s) 82, 104, 251, 664
HpyAV CCTTC 6 cut(s) 558, 636, 841, 946, 998, 1057
HpyCH4III ACNGT 1 cut(s) 248
HpyCH4V TGCA 3 cut(s) 141, 296, 961
HpyF10VI GCNNNNNNNGC 2 cut(s) 332, 341
HpyF3I CTNAG 2 cut(s) 149, 766
Hsp92II CATG 8 cut(s) 52, 118, 344, 585, 611, 670, 755, 881
Kzo9I GATC 3 cut(s) 175, 489, 722
LmnI GCTCC 5 cut(s) 25, 52, 323, 349, 700
LpnPI CCDG 4 cut(s) 107, 134, 214, 721
LweI GCATC 1 cut(s) 14
MaeI CTAG 4 cut(s) 30, 348, 542, 546
MaeIII GTNAC 3 cut(s) 263, 688, 747
MalI GATC 3 cut(s) 177, 491, 724
MboI GATC 3 cut(s) 175, 489, 722
MfeI CAATTG 2 cut(s) 587, 1034
MluCI AATT 8 cut(s) 18, 125, 220, 408, 587, 853, 906, 1034
MlyI GAGTC 2 cut(s) 48, 884
MmeI TCCRAC 1 cut(s) 850
MnlI CCTC 9 cut(s) 201, 272, 381, 390, 396, 517, 920, 954, 1032
MseI TTAA 1 cut(s) 554
MslI CAYNNNNRTG 1 cut(s) 882
MspI CCGG 2 cut(s) 201, 708
MspR9I CCNGG 4 cut(s) 122, 201, 202, 708
MunI CAATTG 2 cut(s) 587, 1034
MvaI CCWGG 1 cut(s) 122
MwoI GCNNNNNNNGC 2 cut(s) 332, 341
NciI CCSGG 3 cut(s) 201, 202, 708
NcoI CCATGG 1 cut(s) 48
NdeII GATC 3 cut(s) 175, 489, 722
NlaIII CATG 8 cut(s) 52, 118, 344, 585, 611, 670, 755, 881
NlaIV GGNNCC 2 cut(s) 27, 702
NmuCI GTSAC 1 cut(s) 747
NspI RCATGY 2 cut(s) 118, 670
PagI TCATGA 1 cut(s) 877
PciI ACATGT 1 cut(s) 114
PfeI GAWTC 3 cut(s) 211, 238, 811
PleI GAGTC 2 cut(s) 47, 884
PpsI GAGTC 2 cut(s) 47, 884
PscI ACATGT 1 cut(s) 114
PsiI TTATAA 1 cut(s) 195
Psp6I CCWGG 1 cut(s) 120
PspEI GGTNACC 1 cut(s) 263
PspGI CCWGG 1 cut(s) 120
PspN4I GGNNCC 2 cut(s) 27, 702
PsrI GAACNNNNNNTAC 2 cut(s) 647, 679
RsaI GTAC 4 cut(s) 83, 119, 528, 665
RsaNI GTAC 4 cut(s) 82, 118, 527, 664
RseI CAYNNNNRTG 1 cut(s) 882
SaqAI TTAA 1 cut(s) 554
Sau3AI GATC 3 cut(s) 175, 489, 722
SchI GAGTC 2 cut(s) 48, 884
ScrFI CCNGG 4 cut(s) 122, 201, 202, 708
SfaNI GCATC 1 cut(s) 14
SmaI CCCGGG 1 cut(s) 202
SmiMI CAYNNNNRTG 1 cut(s) 882
SmlI CTYRAG 3 cut(s) 521, 631, 1019
SmoI CTYRAG 3 cut(s) 521, 631, 1019
Sse9I AATT 8 cut(s) 18, 125, 220, 408, 587, 853, 906, 1034
SsiI CCGC 1 cut(s) 234
SspMI CTAG 4 cut(s) 30, 348, 542, 546
StyD4I CCNGG 4 cut(s) 120, 199, 200, 706
StyI CCWWGG 3 cut(s) 48, 695, 864
TaaI ACNGT 1 cut(s) 248
TasI AATT 8 cut(s) 18, 125, 220, 408, 587, 853, 906, 1034
TatI WGTACW 1 cut(s) 663
TfiI GAWTC 3 cut(s) 211, 238, 811
Tru1I TTAA 1 cut(s) 554
Tru9I TTAA 1 cut(s) 554
TseFI GTSAC 1 cut(s) 747
Tsp45I GTSAC 1 cut(s) 747
TspDTI ATGAA 3 cut(s) 624, 900, 981
TspGWI ACGGA 1 cut(s) 110
TspMI CCCGGG 1 cut(s) 200
XapI RAATTY 1 cut(s) 18
XceI RCATGY 2 cut(s) 118, 670
XmaI CCCGGG 1 cut(s) 200
XspI CTAG 4 cut(s) 30, 348, 542, 546
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.