pycom01g01690

transposition, RNA-mediated

Design Primers CRISPR Design

Basic Information

Type: gene
Biological Identity
pyrus_communis
Chr1
OG0000437
Physical Location & Seq
Forward (+)
1572040 .. 1573527
1488 bp
Loading structure...
UTR
Exon/CDS
Intron
pycom01g01690.5

Sequence Viewer

Length: 1044 bp
ATGCCTAGTTGGCTGGGCCATGTGCTGGGGTGCGCTGTGCTCACTCATGGGTCGCTTATCGTTGGGCCTGTGCTGCTTGCGCCATCTATTGGGCTTACGCTGCATTTGCATCGAGTTAGGACTAGGTTGGGCTGCCTGGCTGGCAGCTCCAGTTGGCTTAAGTCTCCTGCCTTTGGCTCGCAATTAGGCATTATTAGTAGGCATGTCGAAATATGTCTTGATATATGCAACTTGTGTATTCCTTGTGAAGGTCATGATACTAGAACAATTTTTGTTTCCGTCACACCACTAGGAAGTCTTGTAGTTTCTTGTGATCTCTTTTTAAATTGTATGGTTCTTTACTTTGTAAGGTTTTCACACAATCGGAAAAAGATTTTTGAATTCTGGAGTAAACGTCAGGAGCATTTCATAGAAGTGATGTGGTATAAACTAGATCGTTCTACGCCGGGGATTAGGAGGGATCTAGACGAACACAAAATAAGAACTGAGGGGATTTTTGGACGAATTTTAACAAAAATAAAGCTAGCTAGAGGATTGTTCTCCACACATGAAACATATGCATACAAATCGATTTCCAACCCAAGGGCAGCTAAAGACAAAATCGACGAATTTGAATTGAAGTCAAGTTTGTTGCACCACATTCCGAAGTTCCATGGACTGTCCATGGAGGATCCCAACAAGCATTTGAAGGAGTTCGAGGTGGTGTGTTCAAGCATGACTCCAATCAACGTTGATAGTAGTATTTTGAAGATGAAGGCTTTCTCGTTCTCACTATTGGAGAAGGCCAAGGATTTGTTGTACGAGTTAGCACCCGGAACGGTCACTTCTTGGGAGAGCATGAAGAGGGCGTTTCTTGAGAAGTTATTTCCTACTTCAAGACTAAGGGGTTCTTCTCCACACATGTTATACTTGCATACAAGATTGATTCTCAATTTCCCTAAATTCATTGGATTGAATGGAATACGCATTACAACCAAATTATTCTTAATCAAAGTCCCTAACTATGGAATACGCATGATAGAGACATTCAACAAAGATCATTAA
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families
RVT_1 Retrotrans_gag rve

Protein Analysis

348

Amino Acids

39.57

Weight (kDa)

9.52

Isoelectric Point (pI)

36.32

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready
iTOL Interactive Tree Of Life · Most popular EvolView Flexible annotations MEGA Desktop phylogenetics suite FigTree Desktop tree editor

Orthologous Genes (Group: OG0000437)

Species Orthologous Gene IDs
arabidopsis_thaliana AT2G06105
fragaria_vesca FvH4_1g09709 FvH4_4g02101 FvH4_4g08975 FvH4_6g23372 FvH4_6g39851 FvH4_c1g00300
malus_domestica MD01G1176100.v1.1 MD09G1284900.v1.1 MD15G1306600.v1.1
prunus_persica Prupe.1G227700_v2.0.a1
pyrus_communis pycom01g00630 pycom01g01020 pycom01g01690 pycom01g01760 pycom01g04190 pycom01g04400 pycom02g18130 pycom03g10160 pycom05g06370 pycom05g08930 pycom06g05590 pycom10g06320 pycom11g14330 pycom11g15320 pycom11g16240 pycom12416g00050 pycom12420g00010 pycom12420g00120 pycom12426g00180 pycom12426g00710 pycom12531g00010 pycom1256g00020 pycom1256g00050 pycom1341g00030 pycom1353g00030 pycom13g23070 pycom13g23210 pycom13g26260 pycom13g26370 pycom13g26470 pycom13g26980 pycom14g08550 pycom14g08850 pycom1534g00040 pycom15g28760 pycom15g31230 pycom1604g00040 pycom16g21900 pycom16g26030 pycom1739g00020 pycom1739g00050 pycom17g12970 pycom17g17960 pycom17g18300 pycom17g18650 pycom2172g00020 pycom2438g00020 pycom436g00370 pycom436g00390 pycom576g00050 pycom76g00020
rosa_chinensis RchiOBHm_Chr1g0320811 RchiOBHm_Chr2g0135321 RchiOBHm_Chr3g0485721 RchiOBHm_Chr7g0236571
rosa_multiflora Rmu_sc0000185.1_g000007 Rmu_sc0002094.1_g000030 Rmu_sc0002764.1_g000007 Rmu_sc0002809.1_g000014 Rmu_sc0003005.1_g000007 Rmu_sc0003798.1_g000005 Rmu_sc0004646.1_g000027 Rmu_sc0004665.1_g000009 Rmu_sc0004818.1_g000001 Rmu_sc0004988.1_g000031 Rmu_sc0006373.1_g000007 Rmu_sc0007142.1_g000015 Rmu_sc0009930.1_g000001 Rmu_sc0011451.1_g000001 Rmu_sc0020424.1_g000001 Rmu_sc0036944.1_g000001 Rmu_ssc0000062.1_g000010
rosa_roxburghii Rroxscaffold_2G00123930 Rroxscaffold_3G00231480 Rroxscaffold_6G00413880
rosa_rugosa Rorug04G0084800
rosa_samantha Rh3BG150500 Rh6DG232400
rosa_wichuraiana Rw2G018400 Rw3G027860 Rw4G021220 Rw6G020670 Rw6G037970

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AccB7I CCANNNNNTGG 2 cut(s) 25, 89
AclI AACGTT 1 cut(s) 729
AclWI GGATC 3 cut(s) 468, 665, 678
AcsI RAATTY 4 cut(s) 380, 504, 608, 941
AfaI GTAC 1 cut(s) 800
AfiI CCNNNNNNNGG 6 cut(s) 25, 89, 173, 248, 582, 1004
AflII CTTAAG 1 cut(s) 158
AflIII ACRYGT 1 cut(s) 900
AgsI TTSAA 9 cut(s) 380, 614, 619, 688, 711, 748, 876, 955, 1030
AjnI CCWGG 1 cut(s) 135
AluBI AGCT 4 cut(s) 147, 523, 527, 590
AluI AGCT 4 cut(s) 147, 523, 527, 590
Alw21I GWGCWC 1 cut(s) 42
Alw26I GTCTC 2 cut(s) 168, 1016
AlwI GGATC 3 cut(s) 468, 665, 678
AoxI GGCC 3 cut(s) 16, 65, 783
ApeKI GCWGC 5 cut(s) 73, 100, 132, 144, 587
ApoI RAATTY 4 cut(s) 380, 504, 608, 941
Asp700I GAANNNNTTC 2 cut(s) 692, 758
AspLEI GCGC 2 cut(s) 35, 82
AspS9I GGNCC 2 cut(s) 16, 65
AsuC2I CCSGG 2 cut(s) 447, 813
AsuNHI GCTAGC 1 cut(s) 523
BamHI GGATCC 1 cut(s) 670
Bbv12I GWGCWC 1 cut(s) 42
BbvI GCAGC 5 cut(s) 60, 87, 119, 156, 599
BccI CCATC 1 cut(s) 91
BcgI CGANNNNNNTGC 4 cut(s) 92, 126, 549, 583
BciT130I CCWGG 1 cut(s) 137
BcnI CCSGG 2 cut(s) 447, 813
BcoDI GTCTC 2 cut(s) 168, 1016
BfaI CTAG 8 cut(s) 6, 123, 261, 290, 431, 464, 524, 528
BfrI CTTAAG 1 cut(s) 158
BglI GCCNNNNNGGC 2 cut(s) 10, 141
BisI GCNGC 5 cut(s) 74, 101, 133, 145, 588
BlsI GCNGC 5 cut(s) 75, 102, 134, 146, 589
Bme1390I CCNGG 3 cut(s) 137, 447, 813
BmgT120I GGNCC 2 cut(s) 16, 65
BmiI GGNNCC 1 cut(s) 672
BmrFI CCNGG 3 cut(s) 137, 447, 813
BmsI GCATC 1 cut(s) 118
BmtI GCTAGC 1 cut(s) 527
BpmI CTGGAG 2 cut(s) 133, 406
BpuEI CTTGAG 1 cut(s) 875
BpuMI CCSGG 2 cut(s) 447, 813
Bsa29I ATCGAT 1 cut(s) 569
BsaJI CCNNGG 5 cut(s) 446, 581, 652, 663, 786
BsaXI ACNNNNNCTCC 2 cut(s) 379, 409
Bsc4I CCNNNNNNNGG 6 cut(s) 25, 89, 173, 248, 582, 1004
Bse1I ACTGG 1 cut(s) 150
BseBI CCWGG 1 cut(s) 137
BseCI ATCGAT 1 cut(s) 569
BseDI CCNNGG 5 cut(s) 446, 581, 652, 663, 786
BseLI CCNNNNNNNGG 6 cut(s) 25, 89, 173, 248, 582, 1004
BseMII CTCAG 1 cut(s) 477
BseNI ACTGG 1 cut(s) 150
BseXI GCAGC 5 cut(s) 60, 87, 119, 156, 599
BseYI CCCAGC 2 cut(s) 13, 25
BshFI GGCC 3 cut(s) 18, 67, 785
BshVI ATCGAT 1 cut(s) 569
BsiHKAI GWGCWC 1 cut(s) 42
BsiSI CCGG 2 cut(s) 446, 813
BslFI GGGAC 1 cut(s) 980
BslI CCNNNNNNNGG 6 cut(s) 25, 89, 173, 248, 582, 1004
BsmAI GTCTC 2 cut(s) 168, 1016
BsmFI GGGAC 1 cut(s) 980
BsnI GGCC 3 cut(s) 18, 67, 785
Bsp1286I GDGCHC 1 cut(s) 42
Bsp143I GATC 5 cut(s) 313, 433, 460, 670, 1036
Bsp19I CCATGG 2 cut(s) 652, 663
BspANI GGCC 3 cut(s) 18, 67, 785
BspCNI CTCAG 1 cut(s) 478
BspDI ATCGAT 1 cut(s) 569
BspHI TCATGA 1 cut(s) 253
BspLI GGNNCC 1 cut(s) 672
BspOI GCTAGC 1 cut(s) 527
BspPI GGATC 3 cut(s) 468, 665, 678
BspTI CTTAAG 1 cut(s) 158
BsrI ACTGG 1 cut(s) 150
BssECI CCNNGG 5 cut(s) 446, 581, 652, 663, 786
BssMI GATC 5 cut(s) 313, 433, 460, 670, 1036
BssT1I CCWWGG 4 cut(s) 581, 652, 663, 786
Bst2UI CCWGG 1 cut(s) 137
Bst4CI ACNGT 2 cut(s) 660, 820
Bst6I CTCTTC 1 cut(s) 836
BstAFI CTTAAG 1 cut(s) 158
BstC8I GCNNGC 4 cut(s) 78, 142, 179, 525
BstDEI CTNAG 2 cut(s) 486, 881
BstDSI CCRYGG 2 cut(s) 652, 663
BstENI CCTNNNNNAGG 1 cut(s) 246
BstHHI GCGC 2 cut(s) 35, 82
BstKTI GATC 5 cut(s) 316, 436, 463, 673, 1039
BstMAI GTCTC 2 cut(s) 168, 1016
BstMBI GATC 5 cut(s) 313, 433, 460, 670, 1036
BstMWI GCNNNNNNNGC 6 cut(s) 10, 73, 79, 100, 106, 141
BstNI CCWGG 1 cut(s) 137
BstNSI RCATGY 2 cut(s) 206, 904
BstSCI CCNGG 3 cut(s) 135, 445, 811
BstV1I GCAGC 5 cut(s) 60, 87, 119, 156, 599
BstX2I RGATCY 2 cut(s) 460, 670
BstYI RGATCY 2 cut(s) 460, 670
Bsu15I ATCGAT 1 cut(s) 569
BsuRI GGCC 3 cut(s) 18, 67, 785
BsuTUI ATCGAT 1 cut(s) 569
BtgI CCRYGG 2 cut(s) 652, 663
Cac8I GCNNGC 4 cut(s) 78, 142, 179, 525
CciI TCATGA 1 cut(s) 253
CfoI GCGC 2 cut(s) 35, 82
Cfr13I GGNCC 2 cut(s) 16, 65
ClaI ATCGAT 1 cut(s) 569
Csp6I GTAC 1 cut(s) 799
CviQI GTAC 1 cut(s) 799
DdeI CTNAG 2 cut(s) 486, 881
DpnI GATC 5 cut(s) 315, 435, 462, 672, 1038
DpnII GATC 5 cut(s) 313, 433, 460, 670, 1036
DraI TTTAAA 1 cut(s) 324
Eam1104I CTCTTC 1 cut(s) 836
EarI CTCTTC 1 cut(s) 836
Eco130I CCWWGG 4 cut(s) 581, 652, 663, 786
EcoNI CCTNNNNNAGG 1 cut(s) 246
EcoRI GAATTC 1 cut(s) 380
EcoRII CCWGG 1 cut(s) 135
EcoT14I CCWWGG 4 cut(s) 581, 652, 663, 786
EcoT22I ATGCAT 1 cut(s) 562
ErhI CCWWGG 4 cut(s) 581, 652, 663, 786
FalI AAGNNNNNCTT 2 cut(s) 874, 906
FaqI GGGAC 1 cut(s) 980
FauNDI CATATG 1 cut(s) 556
Fnu4HI GCNGC 5 cut(s) 74, 101, 133, 145, 588
Fsp4HI GCNGC 5 cut(s) 74, 101, 133, 145, 588
FspBI CTAG 8 cut(s) 6, 123, 261, 290, 431, 464, 524, 528
GlaI GCGC 2 cut(s) 34, 81
GluI GCNGC 5 cut(s) 74, 101, 133, 145, 588
GsaI CCCAGC 2 cut(s) 17, 29
GsuI CTGGAG 2 cut(s) 133, 406
HaeIII GGCC 3 cut(s) 18, 67, 785
HapII CCGG 2 cut(s) 446, 813
HhaI GCGC 2 cut(s) 35, 82
Hin6I GCGC 2 cut(s) 33, 80
HinP1I GCGC 2 cut(s) 33, 80
HinfI GANTC 2 cut(s) 718, 925
HpaII CCGG 2 cut(s) 446, 813
Hpy166II GTNNAC 1 cut(s) 392
Hpy188I TCNGA 2 cut(s) 366, 645
Hpy188III TCNNGA 7 cut(s) 218, 254, 385, 398, 464, 854, 876
Hpy8I GTNNAC 1 cut(s) 392
Hpy99I CGWCG 1 cut(s) 608
HpyAV CCTTC 4 cut(s) 242, 682, 748, 775
HpyCH4III ACNGT 2 cut(s) 660, 820
HpyCH4IV ACGT 2 cut(s) 394, 729
HpyCH4V TGCA 6 cut(s) 103, 109, 228, 560, 634, 913
HpyF10VI GCNNNNNNNGC 6 cut(s) 10, 73, 79, 100, 106, 141
HpyF3I CTNAG 2 cut(s) 486, 881
HpySE526I ACGT 2 cut(s) 394, 729
HspAI GCGC 2 cut(s) 33, 80
Kzo9I GATC 5 cut(s) 313, 433, 460, 670, 1036
LmnI GCTCC 2 cut(s) 152, 400
Lsp1109I GCAGC 5 cut(s) 60, 87, 119, 156, 599
LweI GCATC 1 cut(s) 118
MaeI CTAG 8 cut(s) 6, 123, 261, 290, 431, 464, 524, 528
MaeII ACGT 2 cut(s) 394, 729
MaeIII GTNAC 2 cut(s) 280, 820
MalI GATC 5 cut(s) 315, 435, 462, 672, 1038
MboI GATC 5 cut(s) 313, 433, 460, 670, 1036
MboII GAAGA 3 cut(s) 760, 853, 882
MflI RGATCY 2 cut(s) 460, 670
MhlI GDGCHC 1 cut(s) 42
MlyI GAGTC 1 cut(s) 712
MmeI TCCRAC 1 cut(s) 600
MnlI CCTC 6 cut(s) 450, 481, 524, 661, 691, 837
Mph1103I ATGCAT 1 cut(s) 562
MroXI GAANNNNTTC 2 cut(s) 692, 758
MseI TTAA 5 cut(s) 159, 323, 509, 986, 1042
MslI CAYNNNNRTG 1 cut(s) 413
MspCI CTTAAG 1 cut(s) 158
MspI CCGG 2 cut(s) 446, 813
MspR9I CCNGG 3 cut(s) 137, 447, 813
MvaI CCWGG 1 cut(s) 137
MwoI GCNNNNNNNGC 6 cut(s) 10, 73, 79, 100, 106, 141
NciI CCSGG 2 cut(s) 447, 813
NcoI CCATGG 2 cut(s) 652, 663
NdeI CATATG 1 cut(s) 556
NdeII GATC 5 cut(s) 313, 433, 460, 670, 1036
NheI GCTAGC 1 cut(s) 523
NlaIV GGNNCC 1 cut(s) 672
NmuCI GTSAC 2 cut(s) 280, 820
NsiI ATGCAT 1 cut(s) 562
NspI RCATGY 2 cut(s) 206, 904
PagI TCATGA 1 cut(s) 253
PciI ACATGT 1 cut(s) 900
PdmI GAANNNNTTC 2 cut(s) 692, 758
PfeI GAWTC 1 cut(s) 925
PflMI CCANNNNNTGG 2 cut(s) 25, 89
PkrI GCNGC 5 cut(s) 75, 102, 134, 146, 589
PleI GAGTC 1 cut(s) 712
PpsI GAGTC 1 cut(s) 712
PscI ACATGT 1 cut(s) 900
Psp1406I AACGTT 1 cut(s) 729
Psp6I CCWGG 1 cut(s) 135
PspFI CCCAGC 2 cut(s) 13, 25
PspGI CCWGG 1 cut(s) 135
PspN4I GGNNCC 1 cut(s) 672
PspPI GGNCC 2 cut(s) 16, 65
PsuI RGATCY 2 cut(s) 460, 670
RsaI GTAC 1 cut(s) 800
RsaNI GTAC 1 cut(s) 799
RseI CAYNNNNRTG 1 cut(s) 413
SaqAI TTAA 5 cut(s) 159, 323, 509, 986, 1042
SatI GCNGC 5 cut(s) 74, 101, 133, 145, 588
Sau3AI GATC 5 cut(s) 313, 433, 460, 670, 1036
Sau96I GGNCC 2 cut(s) 16, 65
SchI GAGTC 1 cut(s) 712
ScrFI CCNGG 3 cut(s) 137, 447, 813
SduI GDGCHC 1 cut(s) 42
SfaNI GCATC 1 cut(s) 118
SmiMI CAYNNNNRTG 1 cut(s) 413
SmlI CTYRAG 2 cut(s) 158, 854
SmoI CTYRAG 2 cut(s) 158, 854
SspMI CTAG 8 cut(s) 6, 123, 261, 290, 431, 464, 524, 528
StyD4I CCNGG 3 cut(s) 135, 445, 811
StyI CCWWGG 4 cut(s) 581, 652, 663, 786
TaaI ACNGT 2 cut(s) 660, 820
TaiI ACGT 2 cut(s) 397, 732
TaqI TCGA 5 cut(s) 112, 207, 569, 603, 696
TfiI GAWTC 1 cut(s) 925
Tru1I TTAA 5 cut(s) 159, 323, 509, 986, 1042
Tru9I TTAA 5 cut(s) 159, 323, 509, 986, 1042
TseFI GTSAC 2 cut(s) 280, 820
TseI GCWGC 5 cut(s) 73, 100, 132, 144, 587
Tsp45I GTSAC 2 cut(s) 280, 820
TspDTI ATGAA 5 cut(s) 397, 564, 767, 854, 934
TspGWI ACGGA 1 cut(s) 268
Van91I CCANNNNNTGG 2 cut(s) 25, 89
Vha464I CTTAAG 1 cut(s) 158
XagI CCTNNNNNAGG 1 cut(s) 246
XapI RAATTY 4 cut(s) 380, 504, 608, 941
XbaI TCTAGA 1 cut(s) 463
XceI RCATGY 2 cut(s) 206, 904
XmnI GAANNNNTTC 2 cut(s) 692, 758
XspI CTAG 8 cut(s) 6, 123, 261, 290, 431, 464, 524, 528
Zsp2I ATGCAT 1 cut(s) 562
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.