Rmu_sc0002094.1_g000030

transposition, RNA-mediated

Basic Information

Type: gene
Biological Identity
rosa_multiflora
Rmu_sc0002094.1
Physical Location & Seq
Reverse (-)
143399 .. 144958
1560 bp
Loading structure...
UTR
Exon/CDS
Intron
Rmu_sc0002094.1_g000030.1.cds

Sequence Viewer

Length: 1560 bp
atgcttgtgggggatgtttcaaacaagatcgaagatgaagcgatgaagattctatatgaagtgagtgaatcttctcaactctatgatagtgcctcggatagaaagccaatgatgatgaagagtgcacaagtacctatgagggagcaagagcaaatgagaggcatgtataatgttgacattccaagtgttcaaatgcaacaagagttgaagcggatagaaggagatatgcaaaagaagcaagatatgattctacaagcacaacaaaaacccttcaatcaaatggcatcaccaagccaaattcaggagcctagtttgggagtcaaagccatggagcaagcttgtttgatttgtgaaagtgtgtatcatagcacaacggagtgttcacaaagcgacatgtatccggaattgatagagcaatgcaatcttctcggctaccaaacaaagccaaaaaatgacccttatagcaacacatataatcccggatggaggaaccaccctaattttggttggggtgggaatcacaaccgtgaacaatgtcaagcttaccaaaggcaaggaggtggatatcaaggtgcaagtagctcacacttcaacaatcaaggagcaaacaatgcttatcatgctcctagaccactttatcaagcaccacctcaacaacctctacctccccaattgccaattcaagaagcaagaaagacacctacccttgaagaaatgatgacgacctttgtgaataatcaagcaaaacaagatgagaagatcagtgtcattcaacagagtgtgggcaagcttaaggtacaaatggggcaactagctaatgagttgagtcaaaggaagcagagtgtgtttccaagccaagtggagaataacccaaggcatgaagccaaagctattaccactttaagaagtggaagacaagtggagaacaatgtgtacatgcctaccaatgaggaagatgtaactccaagggagccacccagttttgaaagaagatcaaaggggaaagcaagagagttgtcacatggagaagtcatcttaggctttaatgatagagaagaacaagtttttaatgataagaagaaggcttgtgccgatgagaagcaagaagaagccttgaaggacaagttcaatgccaaggtcggaactgatgataatgaaacctctccttctactctaaatgaaaggccattcaaaagaggtatcaccttcaaccctcctttgaagattgttcaagataaagaagtgactctcccttaccctcaagctcaaagaaaagtggcattgaagcaaaagaatgagaagttaaagagcaagttcctagatgtgtttaggaaggtggagattaacatccctcttttggatgcaatcaaaaccattcctacctatgccaagtttcttaaggagctttgcaacaacaacaggaccacatttgagaaggatgagaaggtgtgccttagtgagagtgtgagtgcggttttgcaaagaaagctaccacccaagttgaaagatcctttactattccatgcaaagtgggctccaagttctttgatcaagccttga
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families

Protein Analysis

519

Amino Acids

59.19

Weight (kDa)

8.64

Isoelectric Point (pI)

52.46

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Orthologous Genes (Group: OG0000437)

Species Orthologous Gene IDs
arabidopsis_thaliana AT2G06105
fragaria_vesca FvH4_1g09709 FvH4_4g02101 FvH4_4g08975 FvH4_6g23372 FvH4_6g39851 FvH4_c1g00300
malus_domestica MD01G1176100.v1.1 MD09G1284900.v1.1 MD15G1306600.v1.1
prunus_persica Prupe.1G227700_v2.0.a1
pyrus_communis pycom01g00630 pycom01g01020 pycom01g01690 pycom01g01760 pycom01g04190 pycom01g04400 pycom02g18130 pycom03g10160 pycom05g06370 pycom05g08930 pycom06g05590 pycom10g06320 pycom11g14330 pycom11g15320 pycom11g16240 pycom12416g00050 pycom12420g00010 pycom12420g00120 pycom12426g00180 pycom12426g00710 pycom12531g00010 pycom1256g00020 pycom1256g00050 pycom1341g00030 pycom1353g00030 pycom13g23070 pycom13g23210 pycom13g26260 pycom13g26370 pycom13g26470 pycom13g26980 pycom14g08550 pycom14g08850 pycom1534g00040 pycom15g28760 pycom15g31230 pycom1604g00040 pycom16g21900 pycom16g26030 pycom1739g00020 pycom1739g00050 pycom17g12970 pycom17g17960 pycom17g18300 pycom17g18650 pycom2172g00020 pycom2438g00020 pycom436g00370 pycom436g00390 pycom576g00050 pycom76g00020
rosa_chinensis RchiOBHm_Chr1g0320811 RchiOBHm_Chr2g0135321 RchiOBHm_Chr3g0485721 RchiOBHm_Chr7g0236571
rosa_multiflora Rmu_sc0000185.1_g000007 Rmu_sc0002094.1_g000030 Rmu_sc0002764.1_g000007 Rmu_sc0002809.1_g000014 Rmu_sc0003005.1_g000007 Rmu_sc0003798.1_g000005 Rmu_sc0004646.1_g000027 Rmu_sc0004665.1_g000009 Rmu_sc0004818.1_g000001 Rmu_sc0004988.1_g000031 Rmu_sc0006373.1_g000007 Rmu_sc0007142.1_g000015 Rmu_sc0009930.1_g000001 Rmu_sc0011451.1_g000001 Rmu_sc0020424.1_g000001 Rmu_sc0036944.1_g000001 Rmu_ssc0000062.1_g000010
rosa_roxburghii Rroxscaffold_2G00123930 Rroxscaffold_3G00231480 Rroxscaffold_6G00413880
rosa_rugosa Rorug04G0084800
rosa_samantha Rh3BG150500 Rh6DG232400
rosa_wichuraiana Rw2G018400 Rw3G027860 Rw4G021220 Rw6G020670 Rw6G037970

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AccIII TCCGGA 1 cut(s) 400
AciI CCGC 2 cut(s) 211, 1472
AclWI GGATC 1 cut(s) 1502
AcsI RAATTY 1 cut(s) 297
AfaI GTAC 3 cut(s) 132, 798, 935
AfiI CCNNNNNNNGG 5 cut(s) 301, 314, 486, 503, 1357
AflII CTTAAG 2 cut(s) 791, 1397
AflIII ACRYGT 1 cut(s) 393
AjuI GAANNNNNNNTTGG 2 cut(s) 663, 695
AleI CACNNNNGTG 1 cut(s) 525
AluBI AGCT 9 cut(s) 338, 542, 582, 790, 815, 890, 1265, 1405, 1489
AluI AGCT 9 cut(s) 338, 542, 582, 790, 815, 890, 1265, 1405, 1489
Alw21I GWGCWC 1 cut(s) 127
Alw44I GTGCAC 1 cut(s) 123
AlwI GGATC 1 cut(s) 1502
Aor13HI TCCGGA 1 cut(s) 400
AoxI GGCC 1 cut(s) 1184
ApaLI GTGCAC 1 cut(s) 123
ApoI RAATTY 1 cut(s) 297
AspS9I GGNCC 1 cut(s) 1422
AsuC2I CCSGG 1 cut(s) 480
AsuHPI GGTGA 2 cut(s) 279, 1195
AvaII GGWCC 1 cut(s) 1422
BaeGI GKGCMC 1 cut(s) 127
BanII GRGCYC 1 cut(s) 1537
BbsI GAAGAC 1 cut(s) 919
Bbv12I GWGCWC 1 cut(s) 127
BccI CCATC 1 cut(s) 477
BcgI CGANNNNNNTGC 2 cut(s) 409, 443
BciVI GTATCC 1 cut(s) 408
BclI TGATCA 1 cut(s) 1548
BcnI CCSGG 1 cut(s) 480
BfaI CTAG 4 cut(s) 309, 627, 812, 1319
BfrI CTTAAG 2 cut(s) 791, 1397
BfuI GTATCC 1 cut(s) 408
Bme1390I CCNGG 1 cut(s) 480
Bme18I GGWCC 1 cut(s) 1422
BmgT120I GGNCC 1 cut(s) 1422
BmiI GGNNCC 4 cut(s) 306, 491, 972, 1536
BmrFI CCNGG 1 cut(s) 480
BmrI ACTGGG 1 cut(s) 972
BmsI GCATC 2 cut(s) 293, 1351
BmuI ACTGGG 1 cut(s) 972
BpiI GAAGAC 1 cut(s) 919
BpuEI CTTGAG 1 cut(s) 1245
BpuMI CCSGG 1 cut(s) 480
BsaBI GATNNNNATC 1 cut(s) 1346
BsaJI CCNNGG 5 cut(s) 93, 327, 872, 965, 1134
BsaWI WCCGGW 1 cut(s) 400
Bsc4I CCNNNNNNNGG 5 cut(s) 301, 314, 486, 503, 1357
Bse1I ACTGG 1 cut(s) 978
Bse3DI GCAATG 1 cut(s) 422
Bse8I GATNNNNATC 1 cut(s) 1346
BseAI TCCGGA 1 cut(s) 400
BseDI CCNNGG 5 cut(s) 93, 327, 872, 965, 1134
BseGI GGATG 5 cut(s) 19, 488, 1347, 1366, 1444
BseJI GATNNNNATC 1 cut(s) 1346
BseLI CCNNNNNNNGG 5 cut(s) 301, 314, 486, 503, 1357
BseMI GCAATG 1 cut(s) 422
BseNI ACTGG 1 cut(s) 978
BseSI GKGCMC 1 cut(s) 127
BshFI GGCC 1 cut(s) 1186
BsiHKAI GWGCWC 1 cut(s) 127
BsiSI CCGG 2 cut(s) 401, 480
BslI CCNNNNNNNGG 5 cut(s) 301, 314, 486, 503, 1357
BsnI GGCC 1 cut(s) 1186
Bsp1286I GDGCHC 2 cut(s) 127, 1537
Bsp13I TCCGGA 1 cut(s) 400
Bsp1407I TGTACA 1 cut(s) 933
Bsp143I GATC 5 cut(s) 27, 759, 992, 1507, 1548
Bsp19I CCATGG 1 cut(s) 327
BspACI CCGC 2 cut(s) 211, 1472
BspANI GGCC 1 cut(s) 1186
BspEI TCCGGA 1 cut(s) 400
BspLI GGNNCC 4 cut(s) 306, 491, 972, 1536
BspPI GGATC 1 cut(s) 1502
BspTI CTTAAG 2 cut(s) 791, 1397
BsrDI GCAATG 1 cut(s) 422
BsrGI TGTACA 1 cut(s) 933
BsrI ACTGG 1 cut(s) 978
BssECI CCNNGG 5 cut(s) 93, 327, 872, 965, 1134
BssMI GATC 5 cut(s) 27, 759, 992, 1507, 1548
BssT1I CCWWGG 4 cut(s) 327, 872, 965, 1134
Bst4CI ACNGT 1 cut(s) 527
Bst6I CTCTTC 1 cut(s) 113
BstAFI CTTAAG 2 cut(s) 791, 1397
BstAPI GCANNNNNTGC 1 cut(s) 611
BstAUI TGTACA 1 cut(s) 933
BstC8I GCNNGC 2 cut(s) 336, 788
BstDEI CTNAG 2 cut(s) 1036, 1454
BstDSI CCRYGG 1 cut(s) 327
BstF5I GGATG 5 cut(s) 19, 488, 1347, 1366, 1444
BstKTI GATC 5 cut(s) 30, 762, 995, 1510, 1551
BstMBI GATC 5 cut(s) 27, 759, 992, 1507, 1548
BstMWI GCNNNNNNNGC 5 cut(s) 235, 611, 620, 1486, 1532
BstNSI RCATGY 3 cut(s) 166, 397, 940
BstSCI CCNGG 1 cut(s) 478
BstSLI GKGCMC 1 cut(s) 127
BstV2I GAAGAC 1 cut(s) 919
BstX2I RGATCY 1 cut(s) 1507
BstYI RGATCY 1 cut(s) 1507
BsuI GTATCC 1 cut(s) 408
BsuRI GGCC 1 cut(s) 1186
BtgI CCRYGG 1 cut(s) 327
BtgZI GCGATG 1 cut(s) 56
BtsCI GGATG 5 cut(s) 19, 488, 1347, 1366, 1444
BtsIMutI CAGTG 1 cut(s) 769
Cac8I GCNNGC 2 cut(s) 336, 788
Cfr13I GGNCC 1 cut(s) 1422
Csp6I GTAC 3 cut(s) 131, 797, 934
CspCI CAANNNNNGTGG 4 cut(s) 840, 875, 1482, 1517
CviAII CATG 8 cut(s) 163, 328, 394, 620, 878, 937, 1022, 1523
CviQI GTAC 3 cut(s) 131, 797, 934
DdeI CTNAG 2 cut(s) 1036, 1454
DpnI GATC 5 cut(s) 29, 761, 994, 1509, 1550
DpnII GATC 5 cut(s) 27, 759, 992, 1507, 1548
Eam1104I CTCTTC 1 cut(s) 113
EarI CTCTTC 1 cut(s) 113
Eco130I CCWWGG 4 cut(s) 327, 872, 965, 1134
Eco24I GRGCYC 1 cut(s) 1537
Eco32I GATATC 1 cut(s) 566
Eco47I GGWCC 1 cut(s) 1422
EcoRV GATATC 1 cut(s) 566
EcoT14I CCWWGG 4 cut(s) 327, 872, 965, 1134
EcoT38I GRGCYC 1 cut(s) 1537
ErhI CCWWGG 4 cut(s) 327, 872, 965, 1134
FaeI CATG 8 cut(s) 166, 331, 397, 623, 881, 940, 1025, 1526
FatI CATG 8 cut(s) 162, 327, 393, 619, 877, 936, 1021, 1522
FbaI TGATCA 1 cut(s) 1548
FokI GGATG 5 cut(s) 26, 495, 1334, 1373, 1451
FriOI GRGCYC 1 cut(s) 1537
FspBI CTAG 4 cut(s) 309, 627, 812, 1319
HaeIII GGCC 1 cut(s) 1186
HapII CCGG 2 cut(s) 401, 480
Hin1II CATG 8 cut(s) 166, 331, 397, 623, 881, 940, 1025, 1526
HincII GTYRAC 1 cut(s) 175
HindII GTYRAC 1 cut(s) 175
HindIII AAGCTT 3 cut(s) 336, 540, 788
HinfI GANTC 7 cut(s) 49, 68, 247, 318, 517, 826, 1246
HpaII CCGG 2 cut(s) 401, 480
HphI GGTGA 2 cut(s) 279, 1195
Hpy166II GTNNAC 5 cut(s) 125, 175, 383, 530, 934
Hpy188I TCNGA 2 cut(s) 97, 1142
Hpy188III TCNNGA 4 cut(s) 302, 401, 683, 1232
Hpy8I GTNNAC 5 cut(s) 125, 175, 383, 530, 934
HpyAV CCTTC 9 cut(s) 212, 280, 1075, 1111, 1176, 1216, 1327, 1429, 1438
HpyCH4III ACNGT 1 cut(s) 527
HpyCH4V TGCA 9 cut(s) 125, 196, 229, 420, 575, 1364, 1410, 1480, 1526
HpyF10VI GCNNNNNNNGC 5 cut(s) 235, 611, 620, 1486, 1532
HpyF3I CTNAG 2 cut(s) 1036, 1454
Hsp92II CATG 8 cut(s) 166, 331, 397, 623, 881, 940, 1025, 1526
Kpn2I TCCGGA 1 cut(s) 400
Ksp22I TGATCA 1 cut(s) 1548
Kzo9I GATC 5 cut(s) 27, 759, 992, 1507, 1548
LmnI GCTCC 8 cut(s) 142, 304, 331, 602, 628, 970, 1402, 1540
LpnPI CCDG 5 cut(s) 287, 414, 493, 991, 1405
LweI GCATC 2 cut(s) 293, 1351
MaeI CTAG 4 cut(s) 309, 627, 812, 1319
MaeIII GTNAC 3 cut(s) 958, 1017, 1243
MalI GATC 5 cut(s) 29, 761, 994, 1509, 1550
MboI GATC 5 cut(s) 27, 759, 992, 1507, 1548
MfeI CAATTG 1 cut(s) 671
MflI RGATCY 1 cut(s) 1507
MhlI GDGCHC 2 cut(s) 127, 1537
MluCI AATT 5 cut(s) 297, 404, 499, 671, 678
MlyI GAGTC 3 cut(s) 327, 835, 1240
MmeI TCCRAC 1 cut(s) 1120
MroI TCCGGA 1 cut(s) 400
MseI TTAA 7 cut(s) 792, 902, 1044, 1068, 1304, 1344, 1398
MslI CAYNNNNRTG 1 cut(s) 525
MspCI CTTAAG 2 cut(s) 791, 1397
MspI CCGG 2 cut(s) 401, 480
MspR9I CCNGG 1 cut(s) 480
MunI CAATTG 1 cut(s) 671
MwoI GCNNNNNNNGC 5 cut(s) 235, 611, 620, 1486, 1532
NciI CCSGG 1 cut(s) 480
NcoI CCATGG 1 cut(s) 327
NdeII GATC 5 cut(s) 27, 759, 992, 1507, 1548
NlaIII CATG 8 cut(s) 166, 331, 397, 623, 881, 940, 1025, 1526
NlaIV GGNNCC 4 cut(s) 306, 491, 972, 1536
NmeAIII GCCGAG 1 cut(s) 408
NmuCI GTSAC 2 cut(s) 1017, 1243
NspI RCATGY 3 cut(s) 166, 397, 940
OliI CACNNNNGTG 1 cut(s) 525
PciI ACATGT 1 cut(s) 393
PfeI GAWTC 4 cut(s) 49, 68, 247, 517
PfoI TCCNGGA 1 cut(s) 478
PleI GAGTC 3 cut(s) 326, 834, 1240
PpsI GAGTC 3 cut(s) 326, 834, 1240
PscI ACATGT 1 cut(s) 393
PspN4I GGNNCC 4 cut(s) 306, 491, 972, 1536
PspPI GGNCC 1 cut(s) 1422
PsrI GAACNNNNNNTAC 2 cut(s) 917, 949
PsuI RGATCY 1 cut(s) 1507
RsaI GTAC 3 cut(s) 132, 798, 935
RsaNI GTAC 3 cut(s) 131, 797, 934
RseI CAYNNNNRTG 1 cut(s) 525
SaqAI TTAA 7 cut(s) 792, 902, 1044, 1068, 1304, 1344, 1398
Sau3AI GATC 5 cut(s) 27, 759, 992, 1507, 1548
Sau96I GGNCC 1 cut(s) 1422
SchI GAGTC 3 cut(s) 327, 835, 1240
ScrFI CCNGG 1 cut(s) 480
SduI GDGCHC 2 cut(s) 127, 1537
SfaNI GCATC 2 cut(s) 293, 1351
SinI GGWCC 1 cut(s) 1422
SmiMI CAYNNNNRTG 1 cut(s) 525
SmlI CTYRAG 3 cut(s) 791, 1260, 1397
SmoI CTYRAG 3 cut(s) 791, 1260, 1397
Sse9I AATT 5 cut(s) 297, 404, 499, 671, 678
SsiI CCGC 2 cut(s) 211, 1472
SspMI CTAG 4 cut(s) 309, 627, 812, 1319
StyD4I CCNGG 1 cut(s) 478
StyI CCWWGG 4 cut(s) 327, 872, 965, 1134
TaaI ACNGT 1 cut(s) 527
TaqI TCGA 1 cut(s) 30
TasI AATT 5 cut(s) 297, 404, 499, 671, 678
TatI WGTACW 1 cut(s) 933
TfiI GAWTC 4 cut(s) 49, 68, 247, 517
Tru1I TTAA 7 cut(s) 792, 902, 1044, 1068, 1304, 1344, 1398
Tru9I TTAA 7 cut(s) 792, 902, 1044, 1068, 1304, 1344, 1398
TscAI CASTG 1 cut(s) 769
TseFI GTSAC 2 cut(s) 1017, 1243
Tsp45I GTSAC 2 cut(s) 1017, 1243
TspDTI ATGAA 7 cut(s) 51, 59, 72, 131, 894, 1170, 1194
TspGWI ACGGA 1 cut(s) 389
TspRI CASTG 1 cut(s) 769
Vha464I CTTAAG 2 cut(s) 791, 1397
VneI GTGCAC 1 cut(s) 123
VpaK11BI GGWCC 1 cut(s) 1422
XapI RAATTY 1 cut(s) 297
XceI RCATGY 3 cut(s) 166, 397, 940
XcmI CCANNNNNNNNNTGG 1 cut(s) 500
XspI CTAG 4 cut(s) 309, 627, 812, 1319
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.