pycom11g15320

protein kinase activity

Design Primers CRISPR Design

Basic Information

Type: gene
Biological Identity
pyrus_communis
Chr11
OG0000437
Physical Location & Seq
Forward (+)
15992174 .. 15992548
375 bp
Loading structure...
UTR
Exon/CDS
Intron
pycom11g15320.1

Sequence Viewer

Length: 375 bp
ATGAAGGCCTTTCCATTCTCACTTATGGACAAGGCCAAAGATTGGTTGTTTGAATTGTCCCCTGGAACTGTCAATTCTTGGGAAAGTATGAAACGTGCATTCTTAGAGAAATTCTTTCCCACTGCCAAGATCATTCTCTTGAGGAAACGAATTAGTGGCATCCAACAAAATCAAGGTGAGTCGTTTCCATCTTATTATGAACGTTTTAAATCACTTGTTGCTTCATGTCCACAGCACCAAATGAAGGAGGAGCTGCTCATTCAATATTTCTACGAGGGACTCCTTCCCATGGAACGTCAAATGCTAGATGCTTCGGCGGGTGGTGCATTAGTGGACAAGACTCTAGTGGATGCCAAAGCTCTAATTGCCAACTGA
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families
Asp_protease_2 RVT_1 Retrotrans_gag rve

Protein Analysis

125

Amino Acids

14.22

Weight (kDa)

8.69

Isoelectric Point (pI)

39.95

Instability Index
Protein Domains (Pfam)
Domain Name Pfam ID Position E-value Description
Retrotrans_gag PF03732 2 - 95 4.3e-22 Retrotransposon gag protein
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready
iTOL Interactive Tree Of Life · Most popular EvolView Flexible annotations MEGA Desktop phylogenetics suite FigTree Desktop tree editor

Orthologous Genes (Group: OG0000437)

Species Orthologous Gene IDs
arabidopsis_thaliana AT2G06105
fragaria_vesca FvH4_1g09709 FvH4_4g02101 FvH4_4g08975 FvH4_6g23372 FvH4_6g39851 FvH4_c1g00300
malus_domestica MD01G1176100.v1.1 MD09G1284900.v1.1 MD15G1306600.v1.1
prunus_persica Prupe.1G227700_v2.0.a1
pyrus_communis pycom01g00630 pycom01g01020 pycom01g01690 pycom01g01760 pycom01g04190 pycom01g04400 pycom02g18130 pycom03g10160 pycom05g06370 pycom05g08930 pycom06g05590 pycom10g06320 pycom11g14330 pycom11g15320 pycom11g16240 pycom12416g00050 pycom12420g00010 pycom12420g00120 pycom12426g00180 pycom12426g00710 pycom12531g00010 pycom1256g00020 pycom1256g00050 pycom1341g00030 pycom1353g00030 pycom13g23070 pycom13g23210 pycom13g26260 pycom13g26370 pycom13g26470 pycom13g26980 pycom14g08550 pycom14g08850 pycom1534g00040 pycom15g28760 pycom15g31230 pycom1604g00040 pycom16g21900 pycom16g26030 pycom1739g00020 pycom1739g00050 pycom17g12970 pycom17g17960 pycom17g18300 pycom17g18650 pycom2172g00020 pycom2438g00020 pycom436g00370 pycom436g00390 pycom576g00050 pycom76g00020
rosa_chinensis RchiOBHm_Chr1g0320811 RchiOBHm_Chr2g0135321 RchiOBHm_Chr3g0485721 RchiOBHm_Chr7g0236571
rosa_multiflora Rmu_sc0000185.1_g000007 Rmu_sc0002094.1_g000030 Rmu_sc0002764.1_g000007 Rmu_sc0002809.1_g000014 Rmu_sc0003005.1_g000007 Rmu_sc0003798.1_g000005 Rmu_sc0004646.1_g000027 Rmu_sc0004665.1_g000009 Rmu_sc0004818.1_g000001 Rmu_sc0004988.1_g000031 Rmu_sc0006373.1_g000007 Rmu_sc0007142.1_g000015 Rmu_sc0009930.1_g000001 Rmu_sc0011451.1_g000001 Rmu_sc0020424.1_g000001 Rmu_sc0036944.1_g000001 Rmu_ssc0000062.1_g000010
rosa_roxburghii Rroxscaffold_2G00123930 Rroxscaffold_3G00231480 Rroxscaffold_6G00413880
rosa_rugosa Rorug04G0084800
rosa_samantha Rh3BG150500 Rh6DG232400
rosa_wichuraiana Rw2G018400 Rw3G027860 Rw4G021220 Rw6G020670 Rw6G037970

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AccB7I CCANNNNNTGG 1 cut(s) 42
AciI CCGC 1 cut(s) 317
AclI AACGTT 1 cut(s) 202
AcsI RAATTY 1 cut(s) 110
AfiI CCNNNNNNNGG 3 cut(s) 42, 244, 289
AgsI TTSAA 2 cut(s) 53, 263
AjnI CCWGG 1 cut(s) 61
AluBI AGCT 2 cut(s) 253, 359
AluI AGCT 2 cut(s) 253, 359
AoxI GGCC 2 cut(s) 6, 33
ApeKI GCWGC 1 cut(s) 253
ApoI RAATTY 1 cut(s) 110
AsuHPI GGTGA 1 cut(s) 188
BbvI GCAGC 1 cut(s) 240
BccI CCATC 1 cut(s) 196
BciT130I CCWGG 1 cut(s) 63
BfaI CTAG 2 cut(s) 305, 344
BisI GCNGC 1 cut(s) 254
BlsI GCNGC 1 cut(s) 255
Bme1390I CCNGG 1 cut(s) 63
BmrFI CCNGG 1 cut(s) 63
BmsI GCATC 3 cut(s) 168, 298, 340
BpuEI CTTGAG 1 cut(s) 160
BsaJI CCNNGG 2 cut(s) 61, 288
Bsc4I CCNNNNNNNGG 3 cut(s) 42, 244, 289
BseBI CCWGG 1 cut(s) 63
BseDI CCNNGG 2 cut(s) 61, 288
BseGI GGATG 2 cut(s) 159, 355
BseLI CCNNNNNNNGG 3 cut(s) 42, 244, 289
BseRI GAGGAG 1 cut(s) 263
BseXI GCAGC 1 cut(s) 240
BshFI GGCC 2 cut(s) 8, 35
BslFI GGGAC 2 cut(s) 43, 291
BslI CCNNNNNNNGG 3 cut(s) 42, 244, 289
BsmFI GGGAC 2 cut(s) 43, 291
BsmI GAATGC 1 cut(s) 98
BsnI GGCC 2 cut(s) 8, 35
Bsp143I GATC 1 cut(s) 129
Bsp19I CCATGG 1 cut(s) 288
BspACI CCGC 1 cut(s) 317
BspANI GGCC 2 cut(s) 8, 35
BssECI CCNNGG 2 cut(s) 61, 288
BssMI GATC 1 cut(s) 129
BssT1I CCWWGG 1 cut(s) 288
Bst2UI CCWGG 1 cut(s) 63
Bst4CI ACNGT 1 cut(s) 70
BstDEI CTNAG 1 cut(s) 103
BstDSI CCRYGG 1 cut(s) 288
BstF5I GGATG 2 cut(s) 159, 355
BstKTI GATC 1 cut(s) 132
BstMBI GATC 1 cut(s) 129
BstMWI GCNNNNNNNGC 2 cut(s) 323, 365
BstNI CCWGG 1 cut(s) 63
BstSCI CCNGG 1 cut(s) 61
BstV1I GCAGC 1 cut(s) 240
BsuRI GGCC 2 cut(s) 8, 35
BtgI CCRYGG 1 cut(s) 288
BtsCI GGATG 2 cut(s) 159, 355
BtsI GCAGTG 1 cut(s) 120
BtsIMutI CAGTG 1 cut(s) 120
CviAII CATG 2 cut(s) 225, 289
CviJI RGCY 4 cut(s) 8, 35, 253, 359
CviKI_1 RGCY 4 cut(s) 8, 35, 253, 359
DdeI CTNAG 1 cut(s) 103
DpnI GATC 1 cut(s) 131
DpnII GATC 1 cut(s) 129
DraI TTTAAA 1 cut(s) 208
Eco130I CCWWGG 1 cut(s) 288
Eco147I AGGCCT 1 cut(s) 8
EcoRII CCWGG 1 cut(s) 61
EcoT14I CCWWGG 1 cut(s) 288
ErhI CCWWGG 1 cut(s) 288
FaeI CATG 2 cut(s) 228, 292
FaiI YATR 5 cut(s) 26, 89, 198, 226, 290
FaqI GGGAC 2 cut(s) 43, 291
FatI CATG 2 cut(s) 224, 288
FauI CCCGC 1 cut(s) 310
Fnu4HI GCNGC 1 cut(s) 254
FokI GGATG 2 cut(s) 146, 362
Fsp4HI GCNGC 1 cut(s) 254
FspBI CTAG 2 cut(s) 305, 344
GluI GCNGC 1 cut(s) 254
HaeIII GGCC 2 cut(s) 8, 35
Hin1II CATG 2 cut(s) 228, 292
HinfI GANTC 3 cut(s) 179, 279, 340
HphI GGTGA 1 cut(s) 188
Hpy166II GTNNAC 2 cut(s) 230, 334
Hpy188III TCNNGA 1 cut(s) 139
Hpy8I GTNNAC 2 cut(s) 230, 334
HpyAV CCTTC 2 cut(s) 238, 293
HpyCH4III ACNGT 1 cut(s) 70
HpyCH4IV ACGT 3 cut(s) 94, 202, 295
HpyCH4V TGCA 2 cut(s) 98, 326
HpyF10VI GCNNNNNNNGC 2 cut(s) 323, 365
HpyF3I CTNAG 1 cut(s) 103
HpySE526I ACGT 3 cut(s) 94, 202, 295
Hsp92II CATG 2 cut(s) 228, 292
Kzo9I GATC 1 cut(s) 129
LmnI GCTCC 1 cut(s) 250
LpnPI CCDG 2 cut(s) 48, 75
Lsp1109I GCAGC 1 cut(s) 240
LweI GCATC 3 cut(s) 168, 298, 340
MaeI CTAG 2 cut(s) 305, 344
MaeII ACGT 3 cut(s) 94, 202, 295
MalI GATC 1 cut(s) 131
MboI GATC 1 cut(s) 129
MluCI AATT 5 cut(s) 53, 73, 110, 150, 363
MlyI GAGTC 3 cut(s) 188, 273, 334
MmeI TCCRAC 1 cut(s) 187
MnlI CCTC 3 cut(s) 135, 241, 268
MseI TTAA 1 cut(s) 207
MspR9I CCNGG 1 cut(s) 63
Mva1269I GAATGC 1 cut(s) 98
MvaI CCWGG 1 cut(s) 63
MwoI GCNNNNNNNGC 2 cut(s) 323, 365
NcoI CCATGG 1 cut(s) 288
NdeII GATC 1 cut(s) 129
NlaIII CATG 2 cut(s) 228, 292
PceI AGGCCT 1 cut(s) 8
PctI GAATGC 1 cut(s) 98
PflMI CCANNNNNTGG 1 cut(s) 42
PkrI GCNGC 1 cut(s) 255
PleI GAGTC 3 cut(s) 187, 273, 334
PpsI GAGTC 3 cut(s) 187, 273, 334
Psp1406I AACGTT 1 cut(s) 202
Psp6I CCWGG 1 cut(s) 61
PspGI CCWGG 1 cut(s) 61
SaqAI TTAA 1 cut(s) 207
SatI GCNGC 1 cut(s) 254
Sau3AI GATC 1 cut(s) 129
SchI GAGTC 3 cut(s) 188, 273, 334
ScrFI CCNGG 1 cut(s) 63
SetI ASST 6 cut(s) 97, 178, 205, 255, 298, 361
SfaNI GCATC 3 cut(s) 168, 298, 340
SmlI CTYRAG 1 cut(s) 139
SmoI CTYRAG 1 cut(s) 139
Sse9I AATT 5 cut(s) 53, 73, 110, 150, 363
SseBI AGGCCT 1 cut(s) 8
SsiI CCGC 1 cut(s) 317
SspI AATATT 1 cut(s) 266
SspMI CTAG 2 cut(s) 305, 344
StuI AGGCCT 1 cut(s) 8
StyD4I CCNGG 1 cut(s) 61
StyI CCWWGG 1 cut(s) 288
TaaI ACNGT 1 cut(s) 70
TaiI ACGT 3 cut(s) 97, 205, 298
TasI AATT 5 cut(s) 53, 73, 110, 150, 363
Tru1I TTAA 1 cut(s) 207
Tru9I TTAA 1 cut(s) 207
TscAI CASTG 1 cut(s) 127
TseI GCWGC 1 cut(s) 253
TspDTI ATGAA 5 cut(s) 17, 104, 213, 213, 257
TspRI CASTG 1 cut(s) 127
Van91I CCANNNNNTGG 1 cut(s) 42
XapI RAATTY 1 cut(s) 110
XspI CTAG 2 cut(s) 305, 344
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.