Rmu_sc0011451.1_g000001

Aspartyl protease

Design Primers CRISPR Design

Basic Information

Type: gene
Biological Identity
rosa_multiflora
Rmu_sc0011451.1
OG0000437
Physical Location & Seq
Forward (+)
32 .. 927
896 bp
Loading structure...
UTR
Exon/CDS
Intron
Rmu_sc0011451.1_g000001.1.cds

Sequence Viewer

Length: 896 bp
atggcatcaccaagccaaattcgggagcctagtttgggagtcaaatccatagagcaagattgcttgatttgcgaaagtgtgtaccatagcacaacggagtgttcacaaagtgacatgtacccggaattgatagagcaatgcaatcttctcagcaaccaaacaaggccaaagaatgatccttatagcaacacttataatcccgggtggaggaatcaccctaattttggttggggcgggaatcaaaaccttgaacaaggtcaaggttaccaaaggcaaggaggtggctatcaaggtgcaagtagctcacacttcaacaatcaaggagcaaacaatgcttatcatgctcctagaccaccttatcaagcaccacctcaacaacctctacctttacaacaagcccaagtgccaattcaagaagcaagaaagacacctacccttgaagaaatgatggcggcctttgtgaataatcaagaaaagcaacatgagaagatcaatgtcattcaacaaagtgtgagcaagcttgaggtacaaatggggcaactagctaatgagttgagtcaaaggaagcaaggtgtgtttccaagccaagtggagaataacccaaggcatgaagccaaagctattaccaccttgagaagtggaaggcaagtggagaacaatgtgtacatgcctaccaataaggaagatgtaactccaagggagccacccggttttgaaagaagatcaaaggggaaagcaagagagttgtcacatggagaagtcatcttaggcttcaatgatggtgaagaagaagctttgaatgataagaagaatgtttatgccgatgagaagcaagaagaagccttgaaggacaagttcaatgccaaggtcggaactcatgataatgaagcctctcc
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families
No domains found.

Protein Analysis

299

Amino Acids

33.57

Weight (kDa)

5.69

Isoelectric Point (pI)

58.75

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready
iTOL Interactive Tree Of Life · Most popular EvolView Flexible annotations MEGA Desktop phylogenetics suite FigTree Desktop tree editor

Orthologous Genes (Group: OG0000437)

Species Orthologous Gene IDs
arabidopsis_thaliana AT2G06105
fragaria_vesca FvH4_1g09709 FvH4_4g02101 FvH4_4g08975 FvH4_6g23372 FvH4_6g39851 FvH4_c1g00300
malus_domestica MD01G1176100.v1.1 MD09G1284900.v1.1 MD15G1306600.v1.1
prunus_persica Prupe.1G227700_v2.0.a1
pyrus_communis pycom01g00630 pycom01g01020 pycom01g01690 pycom01g01760 pycom01g04190 pycom01g04400 pycom02g18130 pycom03g10160 pycom05g06370 pycom05g08930 pycom06g05590 pycom10g06320 pycom11g14330 pycom11g15320 pycom11g16240 pycom12416g00050 pycom12420g00010 pycom12420g00120 pycom12426g00180 pycom12426g00710 pycom12531g00010 pycom1256g00020 pycom1256g00050 pycom1341g00030 pycom1353g00030 pycom13g23070 pycom13g23210 pycom13g26260 pycom13g26370 pycom13g26470 pycom13g26980 pycom14g08550 pycom14g08850 pycom1534g00040 pycom15g28760 pycom15g31230 pycom1604g00040 pycom16g21900 pycom16g26030 pycom1739g00020 pycom1739g00050 pycom17g12970 pycom17g17960 pycom17g18300 pycom17g18650 pycom2172g00020 pycom2438g00020 pycom436g00370 pycom436g00390 pycom576g00050 pycom76g00020
rosa_chinensis RchiOBHm_Chr1g0320811 RchiOBHm_Chr2g0135321 RchiOBHm_Chr3g0485721 RchiOBHm_Chr7g0236571
rosa_multiflora Rmu_sc0000185.1_g000007 Rmu_sc0002094.1_g000030 Rmu_sc0002764.1_g000007 Rmu_sc0002809.1_g000014 Rmu_sc0003005.1_g000007 Rmu_sc0003798.1_g000005 Rmu_sc0004646.1_g000027 Rmu_sc0004665.1_g000009 Rmu_sc0004818.1_g000001 Rmu_sc0004988.1_g000031 Rmu_sc0006373.1_g000007 Rmu_sc0007142.1_g000015 Rmu_sc0009930.1_g000001 Rmu_sc0011451.1_g000001 Rmu_sc0020424.1_g000001 Rmu_sc0036944.1_g000001 Rmu_ssc0000062.1_g000010
rosa_roxburghii Rroxscaffold_2G00123930 Rroxscaffold_3G00231480 Rroxscaffold_6G00413880
rosa_rugosa Rorug04G0084800
rosa_samantha Rh3BG150500 Rh6DG232400
rosa_wichuraiana Rw2G018400 Rw3G027860 Rw4G021220 Rw6G020670 Rw6G037970

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AanI TTATAA 1 cut(s) 195
AciI CCGC 2 cut(s) 234, 452
AclWI GGATC 1 cut(s) 170
AcsI RAATTY 1 cut(s) 18
AdeI CACNNNGTG 1 cut(s) 110
AfaI GTAC 4 cut(s) 83, 119, 528, 665
AfiI CCNNNNNNNGG 4 cut(s) 22, 35, 207, 224
AflIII ACRYGT 1 cut(s) 114
AjuI GAANNNNNNNTTGG 2 cut(s) 393, 425
AluBI AGCT 5 cut(s) 303, 520, 545, 620, 794
AluI AGCT 5 cut(s) 303, 520, 545, 620, 794
AlwI GGATC 1 cut(s) 170
Ama87I CYCGRG 1 cut(s) 200
AoxI GGCC 2 cut(s) 164, 453
ApoI RAATTY 1 cut(s) 18
AsuC2I CCSGG 4 cut(s) 122, 201, 202, 708
AsuHPI GGTGA 2 cut(s) 206, 794
AvaI CYCGRG 1 cut(s) 200
BccI CCATC 2 cut(s) 442, 773
BcnI CCSGG 4 cut(s) 122, 201, 202, 708
BfaI CTAG 3 cut(s) 30, 348, 542
BisI GCNGC 1 cut(s) 453
BlsI GCNGC 1 cut(s) 454
Bme1390I CCNGG 4 cut(s) 122, 201, 202, 708
BmeT110I CYCGRG 1 cut(s) 200
BmiI GGNNCC 2 cut(s) 27, 702
BmrFI CCNGG 4 cut(s) 122, 201, 202, 708
BmsI GCATC 1 cut(s) 14
BpuEI CTTGAG 2 cut(s) 542, 652
BpuMI CCSGG 4 cut(s) 122, 201, 202, 708
BsaJI CCNNGG 4 cut(s) 200, 602, 695, 864
Bsc4I CCNNNNNNNGG 4 cut(s) 22, 35, 207, 224
Bse3DI GCAATG 1 cut(s) 143
BseDI CCNNGG 4 cut(s) 200, 602, 695, 864
BseLI CCNNNNNNNGG 4 cut(s) 22, 35, 207, 224
BseMI GCAATG 1 cut(s) 143
BseMII CTCAG 1 cut(s) 163
BshFI GGCC 2 cut(s) 166, 455
BsiHKCI CYCGRG 1 cut(s) 200
BsiSI CCGG 3 cut(s) 122, 201, 708
BslI CCNNNNNNNGG 4 cut(s) 22, 35, 207, 224
BsnI GGCC 2 cut(s) 166, 455
BsoBI CYCGRG 1 cut(s) 200
Bsp1407I TGTACA 1 cut(s) 663
Bsp143I GATC 3 cut(s) 175, 489, 722
BspACI CCGC 2 cut(s) 234, 452
BspANI GGCC 2 cut(s) 166, 455
BspCNI CTCAG 1 cut(s) 162
BspHI TCATGA 1 cut(s) 877
BspLI GGNNCC 2 cut(s) 27, 702
BspPI GGATC 1 cut(s) 170
BsrDI GCAATG 1 cut(s) 143
BsrGI TGTACA 1 cut(s) 663
BssECI CCNNGG 4 cut(s) 200, 602, 695, 864
BssMI GATC 3 cut(s) 175, 489, 722
BssT1I CCWWGG 3 cut(s) 602, 695, 864
BstAPI GCANNNNNTGC 1 cut(s) 332
BstAUI TGTACA 1 cut(s) 663
BstC8I GCNNGC 1 cut(s) 518
BstDEI CTNAG 2 cut(s) 149, 766
BstEII GGTNACC 1 cut(s) 263
BstKTI GATC 3 cut(s) 178, 492, 725
BstMBI GATC 3 cut(s) 175, 489, 722
BstMWI GCNNNNNNNGC 3 cut(s) 69, 332, 341
BstNSI RCATGY 2 cut(s) 118, 670
BstPI GGTNACC 1 cut(s) 263
BstSCI CCNGG 4 cut(s) 120, 199, 200, 706
BsuRI GGCC 2 cut(s) 166, 455
Cac8I GCNNGC 1 cut(s) 518
CciI TCATGA 1 cut(s) 877
Cfr9I CCCGGG 1 cut(s) 200
Csp6I GTAC 4 cut(s) 82, 118, 527, 664
CspCI CAANNNNNGTGG 2 cut(s) 570, 605
CviAII CATG 7 cut(s) 115, 341, 482, 608, 667, 752, 878
CviQI GTAC 4 cut(s) 82, 118, 527, 664
DdeI CTNAG 2 cut(s) 149, 766
DpnI GATC 3 cut(s) 177, 491, 724
DpnII GATC 3 cut(s) 175, 489, 722
DraIII CACNNNGTG 1 cut(s) 110
Eco130I CCWWGG 3 cut(s) 602, 695, 864
Eco88I CYCGRG 1 cut(s) 200
Eco91I GGTNACC 1 cut(s) 263
EcoO65I GGTNACC 1 cut(s) 263
EcoT14I CCWWGG 3 cut(s) 602, 695, 864
ErhI CCWWGG 3 cut(s) 602, 695, 864
FaeI CATG 7 cut(s) 118, 344, 485, 611, 670, 755, 881
FatI CATG 7 cut(s) 114, 340, 481, 607, 666, 751, 877
FauI CCCGC 1 cut(s) 227
Fnu4HI GCNGC 1 cut(s) 453
Fsp4HI GCNGC 1 cut(s) 453
FspBI CTAG 3 cut(s) 30, 348, 542
GluI GCNGC 1 cut(s) 453
HaeIII GGCC 2 cut(s) 166, 455
HapII CCGG 3 cut(s) 122, 201, 708
Hin1II CATG 7 cut(s) 118, 344, 485, 611, 670, 755, 881
HindIII AAGCTT 2 cut(s) 518, 792
HinfI GANTC 4 cut(s) 39, 211, 238, 556
HpaII CCGG 3 cut(s) 122, 201, 708
HphI GGTGA 2 cut(s) 206, 794
Hpy166II GTNNAC 3 cut(s) 82, 104, 664
Hpy188I TCNGA 1 cut(s) 872
Hpy188III TCNNGA 4 cut(s) 23, 413, 470, 878
Hpy8I GTNNAC 3 cut(s) 82, 104, 664
HpyAV CCTTC 2 cut(s) 636, 841
HpyCH4V TGCA 2 cut(s) 141, 296
HpyF10VI GCNNNNNNNGC 3 cut(s) 69, 332, 341
HpyF3I CTNAG 2 cut(s) 149, 766
Hsp92II CATG 7 cut(s) 118, 344, 485, 611, 670, 755, 881
Kzo9I GATC 3 cut(s) 175, 489, 722
LmnI GCTCC 4 cut(s) 25, 323, 349, 700
LpnPI CCDG 3 cut(s) 135, 214, 721
LweI GCATC 1 cut(s) 14
MaeI CTAG 3 cut(s) 30, 348, 542
MaeIII GTNAC 4 cut(s) 110, 263, 688, 747
MalI GATC 3 cut(s) 177, 491, 724
MboI GATC 3 cut(s) 175, 489, 722
MboII GAAGA 9 cut(s) 137, 452, 499, 695, 732, 797, 800, 820, 848
MluCI AATT 4 cut(s) 18, 125, 220, 408
MlyI GAGTC 2 cut(s) 48, 565
MmeI TCCRAC 1 cut(s) 850
MnlI CCTC 5 cut(s) 201, 272, 381, 390, 517
MslI CAYNNNNRTG 1 cut(s) 882
MspI CCGG 3 cut(s) 122, 201, 708
MspR9I CCNGG 4 cut(s) 122, 201, 202, 708
MwoI GCNNNNNNNGC 3 cut(s) 69, 332, 341
NciI CCSGG 4 cut(s) 122, 201, 202, 708
NdeII GATC 3 cut(s) 175, 489, 722
NlaIII CATG 7 cut(s) 118, 344, 485, 611, 670, 755, 881
NlaIV GGNNCC 2 cut(s) 27, 702
NmuCI GTSAC 2 cut(s) 110, 747
NspI RCATGY 2 cut(s) 118, 670
PagI TCATGA 1 cut(s) 877
PciI ACATGT 1 cut(s) 114
PfeI GAWTC 2 cut(s) 211, 238
PkrI GCNGC 1 cut(s) 454
PleI GAGTC 2 cut(s) 47, 564
PpsI GAGTC 2 cut(s) 47, 564
PscI ACATGT 1 cut(s) 114
PsiI TTATAA 1 cut(s) 195
PspEI GGTNACC 1 cut(s) 263
PspN4I GGNNCC 2 cut(s) 27, 702
PsrI GAACNNNNNNTAC 2 cut(s) 647, 679
RsaI GTAC 4 cut(s) 83, 119, 528, 665
RsaNI GTAC 4 cut(s) 82, 118, 527, 664
RseI CAYNNNNRTG 1 cut(s) 882
SatI GCNGC 1 cut(s) 453
Sau3AI GATC 3 cut(s) 175, 489, 722
SchI GAGTC 2 cut(s) 48, 565
ScrFI CCNGG 4 cut(s) 122, 201, 202, 708
SfaNI GCATC 1 cut(s) 14
SmaI CCCGGG 1 cut(s) 202
SmiMI CAYNNNNRTG 1 cut(s) 882
SmlI CTYRAG 2 cut(s) 521, 631
SmoI CTYRAG 2 cut(s) 521, 631
Sse9I AATT 4 cut(s) 18, 125, 220, 408
SsiI CCGC 2 cut(s) 234, 452
SspMI CTAG 3 cut(s) 30, 348, 542
StyD4I CCNGG 4 cut(s) 120, 199, 200, 706
StyI CCWWGG 3 cut(s) 602, 695, 864
TasI AATT 4 cut(s) 18, 125, 220, 408
TatI WGTACW 1 cut(s) 663
TauI GCSGC 1 cut(s) 455
TfiI GAWTC 2 cut(s) 211, 238
TseFI GTSAC 2 cut(s) 110, 747
Tsp45I GTSAC 2 cut(s) 110, 747
TspDTI ATGAA 1 cut(s) 624
TspGWI ACGGA 1 cut(s) 110
TspMI CCCGGG 1 cut(s) 200
XapI RAATTY 1 cut(s) 18
XceI RCATGY 2 cut(s) 118, 670
XmaI CCCGGG 1 cut(s) 200
XspI CTAG 3 cut(s) 30, 348, 542
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.