RchiOBHm_Chr3g0485721

Retrotransposon gag protein

Design Primers CRISPR Design

Basic Information

Type: gene
Biological Identity
rosa_chinensis
3
OG0000437
Physical Location & Seq
Reverse (-)
32544826 .. 32545354
529 bp
Loading structure...
UTR
Exon/CDS
Intron
PRQ45031

Sequence Viewer

Length: 246 bp
ATGACCCCTACTCGAACACAATACAATCCTGGATGGAAGGATCACCCTAACTTCCATTGGAACAACAATGATAATGTGGTTCGGCCTACTCAAGGTGTCTATAACACGCCACCTGGTTTCCAAGCTCCTAGACAACAAGCATATCAACAAGCTCCACCTCAACAAGCTTCAAGCAAATCATTAGAGGATATGCTCAAGGAGATAGCACTTCATACCTCTACATTCATGCAAGAGACCAAGGCTTAA
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families
Retrotrans_gag

Protein Analysis

81

Amino Acids

9.3

Weight (kDa)

8.12

Isoelectric Point (pI)

35.85

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready
iTOL Interactive Tree Of Life · Most popular EvolView Flexible annotations MEGA Desktop phylogenetics suite FigTree Desktop tree editor

Orthologous Genes (Group: OG0000437)

Species Orthologous Gene IDs
arabidopsis_thaliana AT2G06105
fragaria_vesca FvH4_1g09709 FvH4_4g02101 FvH4_4g08975 FvH4_6g23372 FvH4_6g39851 FvH4_c1g00300
malus_domestica MD01G1176100.v1.1 MD09G1284900.v1.1 MD15G1306600.v1.1
prunus_persica Prupe.1G227700_v2.0.a1
pyrus_communis pycom01g00630 pycom01g01020 pycom01g01690 pycom01g01760 pycom01g04190 pycom01g04400 pycom02g18130 pycom03g10160 pycom05g06370 pycom05g08930 pycom06g05590 pycom10g06320 pycom11g14330 pycom11g15320 pycom11g16240 pycom12416g00050 pycom12420g00010 pycom12420g00120 pycom12426g00180 pycom12426g00710 pycom12531g00010 pycom1256g00020 pycom1256g00050 pycom1341g00030 pycom1353g00030 pycom13g23070 pycom13g23210 pycom13g26260 pycom13g26370 pycom13g26470 pycom13g26980 pycom14g08550 pycom14g08850 pycom1534g00040 pycom15g28760 pycom15g31230 pycom1604g00040 pycom16g21900 pycom16g26030 pycom1739g00020 pycom1739g00050 pycom17g12970 pycom17g17960 pycom17g18300 pycom17g18650 pycom2172g00020 pycom2438g00020 pycom436g00370 pycom436g00390 pycom576g00050 pycom76g00020
rosa_chinensis RchiOBHm_Chr1g0320811 RchiOBHm_Chr2g0135321 RchiOBHm_Chr3g0485721 RchiOBHm_Chr7g0236571
rosa_multiflora Rmu_sc0000185.1_g000007 Rmu_sc0002094.1_g000030 Rmu_sc0002764.1_g000007 Rmu_sc0002809.1_g000014 Rmu_sc0003005.1_g000007 Rmu_sc0003798.1_g000005 Rmu_sc0004646.1_g000027 Rmu_sc0004665.1_g000009 Rmu_sc0004818.1_g000001 Rmu_sc0004988.1_g000031 Rmu_sc0006373.1_g000007 Rmu_sc0007142.1_g000015 Rmu_sc0009930.1_g000001 Rmu_sc0011451.1_g000001 Rmu_sc0020424.1_g000001 Rmu_sc0036944.1_g000001 Rmu_ssc0000062.1_g000010
rosa_roxburghii Rroxscaffold_2G00123930 Rroxscaffold_3G00231480 Rroxscaffold_6G00413880
rosa_rugosa Rorug04G0084800
rosa_samantha Rh3BG150500 Rh6DG232400
rosa_wichuraiana Rw2G018400 Rw3G027860 Rw4G021220 Rw6G020670 Rw6G037970

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AclWI GGATC 1 cut(s) 48
AfiI CCNNNNNNNGG 1 cut(s) 92
AgsI TTSAA 1 cut(s) 171
AjnI CCWGG 2 cut(s) 28, 112
AluBI AGCT 3 cut(s) 125, 152, 167
AluI AGCT 3 cut(s) 125, 152, 167
Alw26I GTCTC 1 cut(s) 227
AlwI GGATC 1 cut(s) 48
AoxI GGCC 1 cut(s) 83
AsuHPI GGTGA 1 cut(s) 35
BccI CCATC 1 cut(s) 27
BciT130I CCWGG 2 cut(s) 30, 114
BcoDI GTCTC 1 cut(s) 227
BfaI CTAG 1 cut(s) 129
Bme1390I CCNGG 2 cut(s) 30, 114
BmrFI CCNGG 2 cut(s) 30, 114
BpuEI CTTGAG 2 cut(s) 75, 179
BsaI GGTCTC 1 cut(s) 227
BsaJI CCNNGG 1 cut(s) 237
Bsc4I CCNNNNNNNGG 1 cut(s) 92
BseBI CCWGG 2 cut(s) 30, 114
BseDI CCNNGG 1 cut(s) 237
BseGI GGATG 1 cut(s) 38
BseLI CCNNNNNNNGG 1 cut(s) 92
BshFI GGCC 1 cut(s) 85
BslI CCNNNNNNNGG 1 cut(s) 92
BsmAI GTCTC 1 cut(s) 227
BsnI GGCC 1 cut(s) 85
Bso31I GGTCTC 1 cut(s) 227
Bsp143I GATC 1 cut(s) 40
BspANI GGCC 1 cut(s) 85
BspPI GGATC 1 cut(s) 48
BspTNI GGTCTC 1 cut(s) 227
BssECI CCNNGG 1 cut(s) 237
BssMI GATC 1 cut(s) 40
BssT1I CCWWGG 1 cut(s) 237
Bst2UI CCWGG 2 cut(s) 30, 114
BstENI CCTNNNNNAGG 1 cut(s) 90
BstF5I GGATG 1 cut(s) 38
BstKTI GATC 1 cut(s) 43
BstMAI GTCTC 1 cut(s) 227
BstMBI GATC 1 cut(s) 40
BstNI CCWGG 2 cut(s) 30, 114
BstSCI CCNGG 2 cut(s) 28, 112
BsuRI GGCC 1 cut(s) 85
BtsCI GGATG 1 cut(s) 38
CsiI ACCWGGT 1 cut(s) 112
CviAII CATG 1 cut(s) 226
CviJI RGCY 5 cut(s) 85, 125, 152, 167, 242
CviKI_1 RGCY 5 cut(s) 85, 125, 152, 167, 242
DpnI GATC 1 cut(s) 42
DpnII GATC 1 cut(s) 40
Eco130I CCWWGG 1 cut(s) 237
Eco31I GGTCTC 1 cut(s) 227
EcoNI CCTNNNNNAGG 1 cut(s) 90
EcoRII CCWGG 2 cut(s) 28, 112
EcoT14I CCWWGG 1 cut(s) 237
ErhI CCWWGG 1 cut(s) 237
FaeI CATG 1 cut(s) 229
FaiI YATR 5 cut(s) 102, 142, 191, 213, 227
FatI CATG 1 cut(s) 225
FokI GGATG 1 cut(s) 45
FspBI CTAG 1 cut(s) 129
HaeIII GGCC 1 cut(s) 85
Hin1II CATG 1 cut(s) 229
HindIII AAGCTT 1 cut(s) 165
HphI GGTGA 1 cut(s) 35
HpyAV CCTTC 1 cut(s) 31
HpyCH4V TGCA 1 cut(s) 229
Hsp92II CATG 1 cut(s) 229
Kzo9I GATC 1 cut(s) 40
LmnI GCTCC 2 cut(s) 130, 157
LpnPI CCDG 4 cut(s) 15, 42, 99, 126
MabI ACCWGGT 1 cut(s) 112
MaeI CTAG 1 cut(s) 129
MalI GATC 1 cut(s) 42
MboI GATC 1 cut(s) 40
MnlI CCTC 3 cut(s) 168, 178, 226
MseI TTAA 1 cut(s) 244
MspR9I CCNGG 2 cut(s) 30, 114
MvaI CCWGG 2 cut(s) 30, 114
NdeII GATC 1 cut(s) 40
NlaIII CATG 1 cut(s) 229
PfoI TCCNGGA 1 cut(s) 28
Psp6I CCWGG 2 cut(s) 28, 112
PspGI CCWGG 2 cut(s) 28, 112
SaqAI TTAA 1 cut(s) 244
Sau3AI GATC 1 cut(s) 40
ScrFI CCNGG 2 cut(s) 30, 114
SetI ASST 7 cut(s) 97, 115, 127, 154, 160, 169, 218
SexAI ACCWGGT 1 cut(s) 112
SmlI CTYRAG 2 cut(s) 90, 194
SmoI CTYRAG 2 cut(s) 90, 194
SspMI CTAG 1 cut(s) 129
StyD4I CCNGG 2 cut(s) 28, 112
StyI CCWWGG 1 cut(s) 237
TaqI TCGA 1 cut(s) 13
Tru1I TTAA 1 cut(s) 244
Tru9I TTAA 1 cut(s) 244
TspDTI ATGAA 2 cut(s) 200, 214
XagI CCTNNNNNAGG 1 cut(s) 90
XspI CTAG 1 cut(s) 129
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.