Rmu_sc0004646.1_g000027

Retrotransposon gag protein

Design Primers CRISPR Design

Basic Information

Type: gene
Biological Identity
rosa_multiflora
Rmu_sc0004646.1
OG0000437
Physical Location & Seq
Reverse (-)
101965 .. 102648
684 bp
Loading structure...
UTR
Exon/CDS
Intron
Rmu_sc0004646.1_g000027.1.cds

Sequence Viewer

Length: 684 bp
atgaacaaaacaggtaaagaagcatataatctgattgatgatttagccgacaacaatagacaattctacacaacagataaacgtacaagaggacgtggagtgtatgacgttgattcaaataaccgaatggtggcagtagaaagaaagctcgacatgctaatgaatgccttgggcaatggcattaaggaaacaactcaggtatgttatatttgttcctattctgatcatactactgataaatgtcctttgtcttctttgtctgaggagcagatgaattatatggggcaacaaaggcctaaatatgaccgttactcgaacacgtacaatccgggatggaaggatcaccctaacttccgttggagcggcaatgacaacgtggttcgacccacccaagatgtctacaatggaccacctggattccaacaatgggctaggcaggaaatttatcaacaatctccccctcaacaaaactcaagcaagtctttggaagaactagtcaaggagatgaccataaacatgaacaccttcatccaagaatcaaaatctcaactcaaggagcatggtcaatctatcaagaacttggaaaggcaggttgggcagcttgcaacagacatgcacactagacttcctggcaccctcactagcacaacaattcaatatcttaaggatggacgtatggcttag
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families
Retrotrans_gag

Protein Analysis

227

Amino Acids

26.23

Weight (kDa)

7.68

Isoelectric Point (pI)

38.39

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready
iTOL Interactive Tree Of Life · Most popular EvolView Flexible annotations MEGA Desktop phylogenetics suite FigTree Desktop tree editor

Orthologous Genes (Group: OG0000437)

Species Orthologous Gene IDs
arabidopsis_thaliana AT2G06105
fragaria_vesca FvH4_1g09709 FvH4_4g02101 FvH4_4g08975 FvH4_6g23372 FvH4_6g39851 FvH4_c1g00300
malus_domestica MD01G1176100.v1.1 MD09G1284900.v1.1 MD15G1306600.v1.1
prunus_persica Prupe.1G227700_v2.0.a1
pyrus_communis pycom01g00630 pycom01g01020 pycom01g01690 pycom01g01760 pycom01g04190 pycom01g04400 pycom02g18130 pycom03g10160 pycom05g06370 pycom05g08930 pycom06g05590 pycom10g06320 pycom11g14330 pycom11g15320 pycom11g16240 pycom12416g00050 pycom12420g00010 pycom12420g00120 pycom12426g00180 pycom12426g00710 pycom12531g00010 pycom1256g00020 pycom1256g00050 pycom1341g00030 pycom1353g00030 pycom13g23070 pycom13g23210 pycom13g26260 pycom13g26370 pycom13g26470 pycom13g26980 pycom14g08550 pycom14g08850 pycom1534g00040 pycom15g28760 pycom15g31230 pycom1604g00040 pycom16g21900 pycom16g26030 pycom1739g00020 pycom1739g00050 pycom17g12970 pycom17g17960 pycom17g18300 pycom17g18650 pycom2172g00020 pycom2438g00020 pycom436g00370 pycom436g00390 pycom576g00050 pycom76g00020
rosa_chinensis RchiOBHm_Chr1g0320811 RchiOBHm_Chr2g0135321 RchiOBHm_Chr3g0485721 RchiOBHm_Chr7g0236571
rosa_multiflora Rmu_sc0000185.1_g000007 Rmu_sc0002094.1_g000030 Rmu_sc0002764.1_g000007 Rmu_sc0002809.1_g000014 Rmu_sc0003005.1_g000007 Rmu_sc0003798.1_g000005 Rmu_sc0004646.1_g000027 Rmu_sc0004665.1_g000009 Rmu_sc0004818.1_g000001 Rmu_sc0004988.1_g000031 Rmu_sc0006373.1_g000007 Rmu_sc0007142.1_g000015 Rmu_sc0009930.1_g000001 Rmu_sc0011451.1_g000001 Rmu_sc0020424.1_g000001 Rmu_sc0036944.1_g000001 Rmu_ssc0000062.1_g000010
rosa_roxburghii Rroxscaffold_2G00123930 Rroxscaffold_3G00231480 Rroxscaffold_6G00413880
rosa_rugosa Rorug04G0084800
rosa_samantha Rh3BG150500 Rh6DG232400
rosa_wichuraiana Rw2G018400 Rw3G027860 Rw4G021220 Rw6G020670 Rw6G037970

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
Acc36I ACCTGC 1 cut(s) 580
AccB1I GGYRCC 1 cut(s) 632
AccBSI CCGCTC 1 cut(s) 363
AccI GTMKAC 1 cut(s) 399
AciI CCGC 1 cut(s) 363
AclWI GGATC 1 cut(s) 348
AcsI RAATTY 1 cut(s) 441
AfaI GTAC 2 cut(s) 85, 323
AfiI CCNNNNNNNGG 2 cut(s) 130, 427
AflII CTTAAG 1 cut(s) 662
AflIII ACRYGT 1 cut(s) 318
AgsI TTSAA 2 cut(s) 117, 656
AhlI ACTAGT 1 cut(s) 493
AjiI CACGTC 1 cut(s) 95
AjnI CCWGG 2 cut(s) 412, 628
AjuI GAANNNNNNNTTGG 2 cut(s) 576, 608
AluBI AGCT 2 cut(s) 148, 601
AluI AGCT 2 cut(s) 148, 601
AlwI GGATC 1 cut(s) 348
AoxI GGCC 1 cut(s) 293
ApeKI GCWGC 1 cut(s) 598
ApoI RAATTY 1 cut(s) 441
Asp700I GAANNNNTTC 1 cut(s) 524
AspS9I GGNCC 1 cut(s) 407
AsuC2I CCSGG 1 cut(s) 330
AsuHPI GGTGA 1 cut(s) 335
AvaII GGWCC 1 cut(s) 407
BanI GGYRCC 1 cut(s) 632
BbsI GAAGAC 1 cut(s) 243
BbvI GCAGC 1 cut(s) 610
BccI CCATC 2 cut(s) 327, 662
BciT130I CCWGG 2 cut(s) 414, 630
BclI TGATCA 1 cut(s) 223
BcnI CCSGG 1 cut(s) 330
BcuI ACTAGT 1 cut(s) 493
BfaI CTAG 4 cut(s) 432, 494, 621, 642
BfrI CTTAAG 1 cut(s) 662
BfuAI ACCTGC 1 cut(s) 580
BisI GCNGC 2 cut(s) 364, 599
BlsI GCNGC 2 cut(s) 365, 600
Bme1390I CCNGG 3 cut(s) 330, 414, 630
Bme18I GGWCC 1 cut(s) 407
BmgBI CACGTC 1 cut(s) 95
BmgT120I GGNCC 1 cut(s) 407
BmiI GGNNCC 1 cut(s) 634
BmrFI CCNGG 3 cut(s) 330, 414, 630
BpiI GAAGAC 1 cut(s) 243
BpuEI CTTGAG 2 cut(s) 457, 536
BpuMI CCSGG 1 cut(s) 330
BsaAI YACGTR 1 cut(s) 321
BsaJI CCNNGG 1 cut(s) 168
Bsc4I CCNNNNNNNGG 2 cut(s) 130, 427
Bse3DI GCAATG 2 cut(s) 181, 373
BseBI CCWGG 2 cut(s) 414, 630
BseDI CCNNGG 1 cut(s) 168
BseGI GGATG 3 cut(s) 338, 528, 673
BseLI CCNNNNNNNGG 2 cut(s) 130, 427
BseMI GCAATG 2 cut(s) 181, 373
BseMII CTCAG 2 cut(s) 209, 252
BseRI GAGGAG 1 cut(s) 278
BseXI GCAGC 1 cut(s) 610
BshFI GGCC 1 cut(s) 295
BshNI GGYRCC 1 cut(s) 632
BsiSI CCGG 1 cut(s) 329
BslI CCNNNNNNNGG 2 cut(s) 130, 427
BsmI GAATGC 1 cut(s) 169
BsnI GGCC 1 cut(s) 295
Bsp143I GATC 2 cut(s) 223, 340
BspACI CCGC 1 cut(s) 363
BspANI GGCC 1 cut(s) 295
BspCNI CTCAG 2 cut(s) 208, 253
BspLI GGNNCC 1 cut(s) 634
BspMI ACCTGC 1 cut(s) 580
BspPI GGATC 1 cut(s) 348
BspT107I GGYRCC 1 cut(s) 632
BspTI CTTAAG 1 cut(s) 662
BsrBI CCGCTC 1 cut(s) 363
BsrDI GCAATG 2 cut(s) 181, 373
BssECI CCNNGG 1 cut(s) 168
BssMI GATC 2 cut(s) 223, 340
BssT1I CCWWGG 1 cut(s) 168
Bst2UI CCWGG 2 cut(s) 414, 630
Bst4CI ACNGT 1 cut(s) 308
BstAFI CTTAAG 1 cut(s) 662
BstBAI YACGTR 1 cut(s) 321
BstC8I GCNNGC 1 cut(s) 603
BstDEI CTNAG 3 cut(s) 195, 261, 681
BstF5I GGATG 3 cut(s) 338, 528, 673
BstKTI GATC 2 cut(s) 226, 343
BstMBI GATC 2 cut(s) 223, 340
BstMWI GCNNNNNNNGC 3 cut(s) 154, 292, 595
BstNI CCWGG 2 cut(s) 414, 630
BstNSI RCATGY 2 cut(s) 157, 616
BstSCI CCNGG 3 cut(s) 328, 412, 628
BstV1I GCAGC 1 cut(s) 610
BstV2I GAAGAC 1 cut(s) 243
BsuRI GGCC 1 cut(s) 295
BtrI CACGTC 1 cut(s) 95
BtsCI GGATG 3 cut(s) 338, 528, 673
BveI ACCTGC 1 cut(s) 580
Cac8I GCNNGC 1 cut(s) 603
Cfr13I GGNCC 1 cut(s) 407
Csp6I GTAC 2 cut(s) 84, 322
CviAII CATG 4 cut(s) 154, 517, 560, 613
CviJI RGCY 6 cut(s) 47, 148, 295, 431, 601, 680
CviKI_1 RGCY 6 cut(s) 47, 148, 295, 431, 601, 680
CviQI GTAC 2 cut(s) 84, 322
DdeI CTNAG 3 cut(s) 195, 261, 681
DpnI GATC 2 cut(s) 225, 342
DpnII GATC 2 cut(s) 223, 340
Eco130I CCWWGG 1 cut(s) 168
Eco147I AGGCCT 1 cut(s) 295
Eco47I GGWCC 1 cut(s) 407
EcoRII CCWGG 2 cut(s) 412, 628
EcoT14I CCWWGG 1 cut(s) 168
ErhI CCWWGG 1 cut(s) 168
FaeI CATG 4 cut(s) 157, 520, 563, 616
FalI AAGNNNNNCTT 2 cut(s) 466, 498
FatI CATG 4 cut(s) 153, 516, 559, 612
FbaI TGATCA 1 cut(s) 223
FblI GTMKAC 1 cut(s) 399
Fnu4HI GCNGC 2 cut(s) 364, 599
FokI GGATG 3 cut(s) 345, 515, 680
Fsp4HI GCNGC 2 cut(s) 364, 599
FspBI CTAG 4 cut(s) 432, 494, 621, 642
GluI GCNGC 2 cut(s) 364, 599
HaeIII GGCC 1 cut(s) 295
HapII CCGG 1 cut(s) 329
Hin1II CATG 4 cut(s) 157, 520, 563, 616
HinfI GANTC 3 cut(s) 113, 417, 536
HpaII CCGG 1 cut(s) 329
HphI GGTGA 1 cut(s) 335
Hpy166II GTNNAC 1 cut(s) 400
Hpy188I TCNGA 3 cut(s) 33, 223, 262
Hpy188III TCNNGA 1 cut(s) 574
Hpy8I GTNNAC 1 cut(s) 400
HpyAV CCTTC 2 cut(s) 331, 535
HpyCH4III ACNGT 1 cut(s) 308
HpyCH4IV ACGT 6 cut(s) 82, 94, 108, 320, 375, 673
HpyCH4V TGCA 2 cut(s) 605, 616
HpyF10VI GCNNNNNNNGC 3 cut(s) 154, 292, 595
HpyF3I CTNAG 3 cut(s) 195, 261, 681
HpySE526I ACGT 6 cut(s) 82, 94, 108, 320, 375, 673
Hsp92II CATG 4 cut(s) 157, 520, 563, 616
Ksp22I TGATCA 1 cut(s) 223
Kzo9I GATC 2 cut(s) 223, 340
LmnI GCTCC 3 cut(s) 265, 360, 556
LpnPI CCDG 8 cut(s) 182, 342, 399, 422, 426, 575, 615, 642
Lsp1109I GCAGC 1 cut(s) 610
MaeI CTAG 4 cut(s) 432, 494, 621, 642
MaeII ACGT 6 cut(s) 82, 94, 108, 320, 375, 673
MaeIII GTNAC 1 cut(s) 308
MalI GATC 2 cut(s) 225, 342
MbiI CCGCTC 1 cut(s) 363
MboI GATC 2 cut(s) 223, 340
MboII GAAGA 2 cut(s) 243, 500
MluCI AATT 4 cut(s) 62, 274, 441, 651
MmeI TCCRAC 2 cut(s) 338, 445
MnlI CCTC 4 cut(s) 83, 256, 471, 647
MroXI GAANNNNTTC 1 cut(s) 524
MseI TTAA 2 cut(s) 183, 663
MslI CAYNNNNRTG 2 cut(s) 158, 515
MspCI CTTAAG 1 cut(s) 662
MspI CCGG 1 cut(s) 329
MspR9I CCNGG 3 cut(s) 330, 414, 630
Mva1269I GAATGC 1 cut(s) 169
MvaI CCWGG 2 cut(s) 414, 630
MwoI GCNNNNNNNGC 3 cut(s) 154, 292, 595
NciI CCSGG 1 cut(s) 330
NdeII GATC 2 cut(s) 223, 340
NlaIII CATG 4 cut(s) 157, 520, 563, 616
NlaIV GGNNCC 1 cut(s) 634
NspI RCATGY 2 cut(s) 157, 616
PceI AGGCCT 1 cut(s) 295
PctI GAATGC 1 cut(s) 169
PdmI GAANNNNTTC 1 cut(s) 524
PfeI GAWTC 3 cut(s) 113, 417, 536
PfoI TCCNGGA 1 cut(s) 328
PkrI GCNGC 2 cut(s) 365, 600
Ppu21I YACGTR 1 cut(s) 321
Psp6I CCWGG 2 cut(s) 412, 628
PspGI CCWGG 2 cut(s) 412, 628
PspN4I GGNNCC 1 cut(s) 634
PspPI GGNCC 1 cut(s) 407
RsaI GTAC 2 cut(s) 85, 323
RsaNI GTAC 2 cut(s) 84, 322
RseI CAYNNNNRTG 2 cut(s) 158, 515
SaqAI TTAA 2 cut(s) 183, 663
SatI GCNGC 2 cut(s) 364, 599
Sau3AI GATC 2 cut(s) 223, 340
Sau96I GGNCC 1 cut(s) 407
ScrFI CCNGG 3 cut(s) 330, 414, 630
SinI GGWCC 1 cut(s) 407
SmiMI CAYNNNNRTG 2 cut(s) 158, 515
SmlI CTYRAG 3 cut(s) 472, 551, 662
SmoI CTYRAG 3 cut(s) 472, 551, 662
SpeI ACTAGT 1 cut(s) 493
Sse9I AATT 4 cut(s) 62, 274, 441, 651
SseBI AGGCCT 1 cut(s) 295
SsiI CCGC 1 cut(s) 363
SspMI CTAG 4 cut(s) 432, 494, 621, 642
StuI AGGCCT 1 cut(s) 295
StyD4I CCNGG 3 cut(s) 328, 412, 628
StyI CCWWGG 1 cut(s) 168
TaaI ACNGT 1 cut(s) 308
TaiI ACGT 6 cut(s) 85, 97, 111, 323, 378, 676
TaqI TCGA 3 cut(s) 150, 314, 382
TasI AATT 4 cut(s) 62, 274, 441, 651
TauI GCSGC 1 cut(s) 366
TfiI GAWTC 3 cut(s) 113, 417, 536
Tru1I TTAA 2 cut(s) 183, 663
Tru9I TTAA 2 cut(s) 183, 663
TseI GCWGC 1 cut(s) 598
TspDTI ATGAA 5 cut(s) 17, 176, 287, 517, 533
TspGWI ACGGA 1 cut(s) 344
Vha464I CTTAAG 1 cut(s) 662
VpaK11BI GGWCC 1 cut(s) 407
XapI RAATTY 1 cut(s) 441
XceI RCATGY 2 cut(s) 157, 616
XmiI GTMKAC 1 cut(s) 399
XmnI GAANNNNTTC 1 cut(s) 524
XspI CTAG 4 cut(s) 432, 494, 621, 642
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.