Rmu_sc0003798.1_g000005

transposition, RNA-mediated

Design Primers CRISPR Design

Basic Information

Type: gene
Biological Identity
rosa_multiflora
Rmu_sc0003798.1
OG0000437
Physical Location & Seq
Reverse (-)
8137 .. 8481
345 bp
Loading structure...
UTR
Exon/CDS
Intron
Rmu_sc0003798.1_g000005.1.cds

Sequence Viewer

Length: 345 bp
atggtggctgtggaaagaaagattgacatgttaatgaatgccttaggcaatagcattaaggcaacacctcaggtatgctctatttgttcctattctgatcatactactgatagatgtcctatgtctgctatatctgaggaacaggtgaattacatggggcaacaaaggcctaaatatgacccttactcgaacacatacaatccgggatggaaggatcacccaaacttccgttggtgcggtaatgacaacgtggttcgacctactgattccaagaagtggctaggcagcaagtctatcaacaaactcctcctcaacaatcctcaagcaagtcattggaagaattag
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families
RVT_1 Retrotrans_gag rve

Protein Analysis

114

Amino Acids

13.06

Weight (kDa)

8.95

Isoelectric Point (pI)

36.93

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready
iTOL Interactive Tree Of Life · Most popular EvolView Flexible annotations MEGA Desktop phylogenetics suite FigTree Desktop tree editor

Orthologous Genes (Group: OG0000437)

Species Orthologous Gene IDs
arabidopsis_thaliana AT2G06105
fragaria_vesca FvH4_1g09709 FvH4_4g02101 FvH4_4g08975 FvH4_6g23372 FvH4_6g39851 FvH4_c1g00300
malus_domestica MD01G1176100.v1.1 MD09G1284900.v1.1 MD15G1306600.v1.1
prunus_persica Prupe.1G227700_v2.0.a1
pyrus_communis pycom01g00630 pycom01g01020 pycom01g01690 pycom01g01760 pycom01g04190 pycom01g04400 pycom02g18130 pycom03g10160 pycom05g06370 pycom05g08930 pycom06g05590 pycom10g06320 pycom11g14330 pycom11g15320 pycom11g16240 pycom12416g00050 pycom12420g00010 pycom12420g00120 pycom12426g00180 pycom12426g00710 pycom12531g00010 pycom1256g00020 pycom1256g00050 pycom1341g00030 pycom1353g00030 pycom13g23070 pycom13g23210 pycom13g26260 pycom13g26370 pycom13g26470 pycom13g26980 pycom14g08550 pycom14g08850 pycom1534g00040 pycom15g28760 pycom15g31230 pycom1604g00040 pycom16g21900 pycom16g26030 pycom1739g00020 pycom1739g00050 pycom17g12970 pycom17g17960 pycom17g18300 pycom17g18650 pycom2172g00020 pycom2438g00020 pycom436g00370 pycom436g00390 pycom576g00050 pycom76g00020
rosa_chinensis RchiOBHm_Chr1g0320811 RchiOBHm_Chr2g0135321 RchiOBHm_Chr3g0485721 RchiOBHm_Chr7g0236571
rosa_multiflora Rmu_sc0000185.1_g000007 Rmu_sc0002094.1_g000030 Rmu_sc0002764.1_g000007 Rmu_sc0002809.1_g000014 Rmu_sc0003005.1_g000007 Rmu_sc0003798.1_g000005 Rmu_sc0004646.1_g000027 Rmu_sc0004665.1_g000009 Rmu_sc0004818.1_g000001 Rmu_sc0004988.1_g000031 Rmu_sc0006373.1_g000007 Rmu_sc0007142.1_g000015 Rmu_sc0009930.1_g000001 Rmu_sc0011451.1_g000001 Rmu_sc0020424.1_g000001 Rmu_sc0036944.1_g000001 Rmu_ssc0000062.1_g000010
rosa_roxburghii Rroxscaffold_2G00123930 Rroxscaffold_3G00231480 Rroxscaffold_6G00413880
rosa_rugosa Rorug04G0084800
rosa_samantha Rh3BG150500 Rh6DG232400
rosa_wichuraiana Rw2G018400 Rw3G027860 Rw4G021220 Rw6G020670 Rw6G037970

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AccB7I CCANNNNNTGG 1 cut(s) 276
AciI CCGC 1 cut(s) 237
AclWI GGATC 1 cut(s) 222
AfiI CCNNNNNNNGG 1 cut(s) 276
AflIII ACRYGT 1 cut(s) 27
AlwI GGATC 1 cut(s) 222
AoxI GGCC 1 cut(s) 167
ApeKI GCWGC 1 cut(s) 285
AsuC2I CCSGG 1 cut(s) 204
AsuHPI GGTGA 2 cut(s) 157, 209
AxyI CCTNAGG 2 cut(s) 43, 69
BbvI GCAGC 1 cut(s) 297
BccI CCATC 1 cut(s) 201
BclI TGATCA 1 cut(s) 97
BcnI CCSGG 1 cut(s) 204
BfaI CTAG 1 cut(s) 281
BisI GCNGC 1 cut(s) 286
BlsI GCNGC 1 cut(s) 287
Bme1390I CCNGG 1 cut(s) 204
BmrFI CCNGG 1 cut(s) 204
BpuEI CTTGAG 1 cut(s) 306
BpuMI CCSGG 1 cut(s) 204
Bsc4I CCNNNNNNNGG 1 cut(s) 276
Bse21I CCTNAGG 2 cut(s) 43, 69
BseGI GGATG 1 cut(s) 212
BseLI CCNNNNNNNGG 1 cut(s) 276
BseMII CTCAG 2 cut(s) 83, 126
BseRI GAGGAG 2 cut(s) 296, 299
BseXI GCAGC 1 cut(s) 297
BshFI GGCC 1 cut(s) 169
BsiSI CCGG 1 cut(s) 203
BslI CCNNNNNNNGG 1 cut(s) 276
BsmI GAATGC 1 cut(s) 43
BsnI GGCC 1 cut(s) 169
Bsp143I GATC 2 cut(s) 97, 214
BspACI CCGC 1 cut(s) 237
BspANI GGCC 1 cut(s) 169
BspCNI CTCAG 2 cut(s) 82, 127
BspPI GGATC 1 cut(s) 222
BssMI GATC 2 cut(s) 97, 214
BstDEI CTNAG 3 cut(s) 43, 69, 135
BstF5I GGATG 1 cut(s) 212
BstKTI GATC 2 cut(s) 100, 217
BstMBI GATC 2 cut(s) 97, 214
BstMWI GCNNNNNNNGC 1 cut(s) 166
BstNSI RCATGY 1 cut(s) 31
BstSCI CCNGG 1 cut(s) 202
BstV1I GCAGC 1 cut(s) 297
Bsu36I CCTNAGG 2 cut(s) 43, 69
BsuRI GGCC 1 cut(s) 169
BtsCI GGATG 1 cut(s) 212
CviAII CATG 2 cut(s) 28, 154
CviJI RGCY 3 cut(s) 8, 169, 280
CviKI_1 RGCY 3 cut(s) 8, 169, 280
DdeI CTNAG 3 cut(s) 43, 69, 135
DpnI GATC 2 cut(s) 99, 216
DpnII GATC 2 cut(s) 97, 214
Eco147I AGGCCT 1 cut(s) 169
Eco81I CCTNAGG 2 cut(s) 43, 69
FaeI CATG 2 cut(s) 31, 157
FaiI YATR 8 cut(s) 29, 76, 102, 122, 131, 155, 177, 196
FatI CATG 2 cut(s) 27, 153
FbaI TGATCA 1 cut(s) 97
Fnu4HI GCNGC 1 cut(s) 286
FokI GGATG 1 cut(s) 219
Fsp4HI GCNGC 1 cut(s) 286
FspBI CTAG 1 cut(s) 281
GluI GCNGC 1 cut(s) 286
HaeIII GGCC 1 cut(s) 169
HapII CCGG 1 cut(s) 203
Hin1II CATG 2 cut(s) 31, 157
HinfI GANTC 1 cut(s) 266
HpaII CCGG 1 cut(s) 203
HphI GGTGA 2 cut(s) 157, 209
Hpy188I TCNGA 2 cut(s) 97, 136
HpyAV CCTTC 1 cut(s) 205
HpyCH4IV ACGT 1 cut(s) 249
HpyF10VI GCNNNNNNNGC 1 cut(s) 166
HpyF3I CTNAG 3 cut(s) 43, 69, 135
HpySE526I ACGT 1 cut(s) 249
Hsp92II CATG 2 cut(s) 31, 157
Ksp22I TGATCA 1 cut(s) 97
Kzo9I GATC 2 cut(s) 97, 214
LpnPI CCDG 3 cut(s) 56, 128, 216
Lsp1109I GCAGC 1 cut(s) 297
MaeI CTAG 1 cut(s) 281
MaeII ACGT 1 cut(s) 249
MalI GATC 2 cut(s) 99, 216
MboI GATC 2 cut(s) 97, 214
MluCI AATT 2 cut(s) 148, 340
MnlI CCTC 5 cut(s) 78, 130, 317, 320, 330
MseI TTAA 2 cut(s) 32, 57
MslI CAYNNNNRTG 1 cut(s) 32
MspI CCGG 1 cut(s) 203
MspR9I CCNGG 1 cut(s) 204
Mva1269I GAATGC 1 cut(s) 43
MwoI GCNNNNNNNGC 1 cut(s) 166
NciI CCSGG 1 cut(s) 204
NdeII GATC 2 cut(s) 97, 214
NlaIII CATG 2 cut(s) 31, 157
NspI RCATGY 1 cut(s) 31
PceI AGGCCT 1 cut(s) 169
PciI ACATGT 1 cut(s) 27
PctI GAATGC 1 cut(s) 43
PfeI GAWTC 1 cut(s) 266
PflMI CCANNNNNTGG 1 cut(s) 276
PfoI TCCNGGA 1 cut(s) 202
PkrI GCNGC 1 cut(s) 287
PscI ACATGT 1 cut(s) 27
RseI CAYNNNNRTG 1 cut(s) 32
SaqAI TTAA 2 cut(s) 32, 57
SatI GCNGC 1 cut(s) 286
Sau3AI GATC 2 cut(s) 97, 214
ScrFI CCNGG 1 cut(s) 204
SetI ASST 5 cut(s) 70, 75, 147, 252, 262
SmiMI CAYNNNNRTG 1 cut(s) 32
SmlI CTYRAG 1 cut(s) 321
SmoI CTYRAG 1 cut(s) 321
Sse9I AATT 2 cut(s) 148, 340
SseBI AGGCCT 1 cut(s) 169
SsiI CCGC 1 cut(s) 237
SspMI CTAG 1 cut(s) 281
StuI AGGCCT 1 cut(s) 169
StyD4I CCNGG 1 cut(s) 202
TaiI ACGT 1 cut(s) 252
TaqI TCGA 2 cut(s) 188, 256
TasI AATT 2 cut(s) 148, 340
TfiI GAWTC 1 cut(s) 266
Tru1I TTAA 2 cut(s) 32, 57
Tru9I TTAA 2 cut(s) 32, 57
TseI GCWGC 1 cut(s) 285
TspDTI ATGAA 1 cut(s) 50
TspGWI ACGGA 1 cut(s) 218
Van91I CCANNNNNTGG 1 cut(s) 276
XceI RCATGY 1 cut(s) 31
XcmI CCANNNNNNNNNTGG 1 cut(s) 228
XspI CTAG 1 cut(s) 281
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.