pycom01g04190

transposition, RNA-mediated

Design Primers CRISPR Design

Basic Information

Type: gene
Biological Identity
pyrus_communis
Chr1
OG0000437
Physical Location & Seq
Forward (+)
3165686 .. 3166411
726 bp
Loading structure...
UTR
Exon/CDS
Intron
pycom01g04190.2

Sequence Viewer

Length: 597 bp
ATGGAGAAAAAGCTTGAAAGATTTGATGCAAAATTTGACATGTTATTACAAAGAATTCCAGGTTCACAGGTTGCTGCACAACAGCCTTTACAAACTGCTTGCAGCATTTGTAACATGACAACACATGATTTTTTGAGTTGTCCACATAAAGATGCTTATCCGGAGTTTACAGTAGAGCAAGTTAATTTTTACAACCCTGGTTGGAGAGATCATCCTAATTTGAAGTGGGATAGAGATCAGCATGCAAAGGCTACTTGGGAGATTGCAATTGAAAAATTAGCAACTACTACAAATGCAAGACTTGAACAGATCAATCAAGAAATCCAAAATATTGCATTGCAGGTTTCAGAAAGAGCACTGGGTCCATTTTCTAGTCAAACAATACCTAATCCAAGAGGACGAGAAGAATGCAACACTATACGGACTTTACAGTCTGGCAAAAATTATGACAACAGACATGAAAACTGCACTGGAAATTCGCAAGCAGCACCACAACCACAAATAGATTCGGGAAATTTTGCAAAATCTAATATTTTTGCAGATTTTGCAATTTTGCAAATTCTAGGCAGCCACAAGAAAGATCTAAAAATACTATAG
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families
RVT_1 Retrotrans_gag rve

Protein Analysis

199

Amino Acids

22.51

Weight (kDa)

6.59

Isoelectric Point (pI)

55.17

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready
iTOL Interactive Tree Of Life · Most popular EvolView Flexible annotations MEGA Desktop phylogenetics suite FigTree Desktop tree editor

Orthologous Genes (Group: OG0000437)

Species Orthologous Gene IDs
arabidopsis_thaliana AT2G06105
fragaria_vesca FvH4_1g09709 FvH4_4g02101 FvH4_4g08975 FvH4_6g23372 FvH4_6g39851 FvH4_c1g00300
malus_domestica MD01G1176100.v1.1 MD09G1284900.v1.1 MD15G1306600.v1.1
prunus_persica Prupe.1G227700_v2.0.a1
pyrus_communis pycom01g00630 pycom01g01020 pycom01g01690 pycom01g01760 pycom01g04190 pycom01g04400 pycom02g18130 pycom03g10160 pycom05g06370 pycom05g08930 pycom06g05590 pycom10g06320 pycom11g14330 pycom11g15320 pycom11g16240 pycom12416g00050 pycom12420g00010 pycom12420g00120 pycom12426g00180 pycom12426g00710 pycom12531g00010 pycom1256g00020 pycom1256g00050 pycom1341g00030 pycom1353g00030 pycom13g23070 pycom13g23210 pycom13g26260 pycom13g26370 pycom13g26470 pycom13g26980 pycom14g08550 pycom14g08850 pycom1534g00040 pycom15g28760 pycom15g31230 pycom1604g00040 pycom16g21900 pycom16g26030 pycom1739g00020 pycom1739g00050 pycom17g12970 pycom17g17960 pycom17g18300 pycom17g18650 pycom2172g00020 pycom2438g00020 pycom436g00370 pycom436g00390 pycom576g00050 pycom76g00020
rosa_chinensis RchiOBHm_Chr1g0320811 RchiOBHm_Chr2g0135321 RchiOBHm_Chr3g0485721 RchiOBHm_Chr7g0236571
rosa_multiflora Rmu_sc0000185.1_g000007 Rmu_sc0002094.1_g000030 Rmu_sc0002764.1_g000007 Rmu_sc0002809.1_g000014 Rmu_sc0003005.1_g000007 Rmu_sc0003798.1_g000005 Rmu_sc0004646.1_g000027 Rmu_sc0004665.1_g000009 Rmu_sc0004818.1_g000001 Rmu_sc0004988.1_g000031 Rmu_sc0006373.1_g000007 Rmu_sc0007142.1_g000015 Rmu_sc0009930.1_g000001 Rmu_sc0011451.1_g000001 Rmu_sc0020424.1_g000001 Rmu_sc0036944.1_g000001 Rmu_ssc0000062.1_g000010
rosa_roxburghii Rroxscaffold_2G00123930 Rroxscaffold_3G00231480 Rroxscaffold_6G00413880
rosa_rugosa Rorug04G0084800
rosa_samantha Rh3BG150500 Rh6DG232400
rosa_wichuraiana Rw2G018400 Rw3G027860 Rw4G021220 Rw6G020670 Rw6G037970

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AasI GACNNNNNNGTC 1 cut(s) 430
Acc36I ACCTGC 1 cut(s) 331
AccIII TCCGGA 1 cut(s) 160
AcsI RAATTY 5 cut(s) 32, 54, 475, 514, 558
AflIII ACRYGT 1 cut(s) 39
AgsI TTSAA 4 cut(s) 17, 223, 272, 305
AjnI CCWGG 2 cut(s) 58, 196
AluBI AGCT 1 cut(s) 13
AluI AGCT 1 cut(s) 13
Alw21I GWGCWC 1 cut(s) 358
Aor13HI TCCGGA 1 cut(s) 160
ApeKI GCWGC 4 cut(s) 74, 102, 485, 567
ApoI RAATTY 5 cut(s) 32, 54, 475, 514, 558
AspS9I GGNCC 1 cut(s) 362
AvaII GGWCC 1 cut(s) 362
Bbv12I GWGCWC 1 cut(s) 358
BbvI GCAGC 4 cut(s) 61, 114, 497, 579
BcgI CGANNNNNNTGC 2 cut(s) 390, 424
BciT130I CCWGG 2 cut(s) 60, 198
BfaI CTAG 2 cut(s) 372, 563
BfmI CTRYAG 1 cut(s) 593
BfuAI ACCTGC 1 cut(s) 331
BglII AGATCT 1 cut(s) 580
BisI GCNGC 4 cut(s) 75, 103, 486, 568
BlsI GCNGC 4 cut(s) 76, 104, 487, 569
Bme1390I CCNGG 2 cut(s) 60, 198
Bme18I GGWCC 1 cut(s) 362
BmgT120I GGNCC 1 cut(s) 362
BmiI GGNNCC 1 cut(s) 363
BmrFI CCNGG 2 cut(s) 60, 198
BmrI ACTGGG 1 cut(s) 368
BmsI GCATC 2 cut(s) 16, 142
BmuI ACTGGG 1 cut(s) 368
BsaBI GATNNNNATC 2 cut(s) 156, 234
BsaJI CCNNGG 1 cut(s) 196
BsaWI WCCGGW 1 cut(s) 160
Bse1I ACTGG 2 cut(s) 363, 475
Bse3DI GCAATG 1 cut(s) 335
Bse8I GATNNNNATC 2 cut(s) 156, 234
BseAI TCCGGA 1 cut(s) 160
BseBI CCWGG 2 cut(s) 60, 198
BseDI CCNNGG 1 cut(s) 196
BseGI GGATG 1 cut(s) 211
BseJI GATNNNNATC 2 cut(s) 156, 234
BseMI GCAATG 1 cut(s) 335
BseNI ACTGG 2 cut(s) 363, 475
BseXI GCAGC 4 cut(s) 61, 114, 497, 579
BsgI GTGCAG 2 cut(s) 60, 451
BsiHKAI GWGCWC 1 cut(s) 358
BsiSI CCGG 1 cut(s) 161
BsmI GAATGC 1 cut(s) 413
Bsp1286I GDGCHC 1 cut(s) 358
Bsp13I TCCGGA 1 cut(s) 160
Bsp143I GATC 4 cut(s) 208, 235, 309, 580
BspEI TCCGGA 1 cut(s) 160
BspLI GGNNCC 1 cut(s) 363
BspMI ACCTGC 1 cut(s) 331
BsrDI GCAATG 1 cut(s) 335
BsrI ACTGG 2 cut(s) 363, 475
BssECI CCNNGG 1 cut(s) 196
BssMI GATC 4 cut(s) 208, 235, 309, 580
Bst2UI CCWGG 2 cut(s) 60, 198
Bst4CI ACNGT 2 cut(s) 172, 432
BstAPI GCANNNNNTGC 1 cut(s) 545
BstC8I GCNNGC 3 cut(s) 100, 243, 483
BstF5I GGATG 1 cut(s) 211
BstKTI GATC 4 cut(s) 211, 238, 312, 583
BstMBI GATC 4 cut(s) 208, 235, 309, 580
BstMWI GCNNNNNNNGC 1 cut(s) 545
BstNI CCWGG 2 cut(s) 60, 198
BstNSI RCATGY 2 cut(s) 43, 245
BstSCI CCNGG 2 cut(s) 58, 196
BstSFI CTRYAG 1 cut(s) 593
BstV1I GCAGC 4 cut(s) 61, 114, 497, 579
BstX2I RGATCY 1 cut(s) 580
BstYI RGATCY 1 cut(s) 580
BtsCI GGATG 1 cut(s) 211
BtsIMutI CAGTG 2 cut(s) 356, 468
BveI ACCTGC 1 cut(s) 331
Cac8I GCNNGC 3 cut(s) 100, 243, 483
Cfr13I GGNCC 1 cut(s) 362
CviAII CATG 5 cut(s) 40, 115, 125, 242, 458
CviJI RGCY 4 cut(s) 13, 85, 251, 570
CviKI_1 RGCY 4 cut(s) 13, 85, 251, 570
DpnI GATC 4 cut(s) 210, 237, 311, 582
DpnII GATC 4 cut(s) 208, 235, 309, 580
DrdI GACNNNNNNGTC 1 cut(s) 430
DseDI GACNNNNNNGTC 1 cut(s) 430
Eco47I GGWCC 1 cut(s) 362
EcoRI GAATTC 1 cut(s) 54
EcoRII CCWGG 2 cut(s) 58, 196
FaeI CATG 5 cut(s) 43, 118, 128, 245, 461
FaiI YATR 9 cut(s) 41, 116, 126, 147, 243, 419, 447, 459, 595
FatI CATG 5 cut(s) 39, 114, 124, 241, 457
Fnu4HI GCNGC 4 cut(s) 75, 103, 486, 568
FokI GGATG 1 cut(s) 198
Fsp4HI GCNGC 4 cut(s) 75, 103, 486, 568
FspBI CTAG 2 cut(s) 372, 563
GluI GCNGC 4 cut(s) 75, 103, 486, 568
HapII CCGG 1 cut(s) 161
Hin1II CATG 5 cut(s) 43, 118, 128, 245, 461
HindIII AAGCTT 1 cut(s) 11
HinfI GANTC 1 cut(s) 506
HpaII CCGG 1 cut(s) 161
Hpy166II GTNNAC 3 cut(s) 65, 143, 168
Hpy188I TCNGA 1 cut(s) 349
Hpy188III TCNNGA 3 cut(s) 161, 317, 510
Hpy8I GTNNAC 3 cut(s) 65, 143, 168
HpyCH4III ACNGT 2 cut(s) 172, 432
HpyF10VI GCNNNNNNNGC 1 cut(s) 545
Hsp92II CATG 5 cut(s) 43, 118, 128, 245, 461
Kpn2I TCCGGA 1 cut(s) 160
Kzo9I GATC 4 cut(s) 208, 235, 309, 580
Lsp1109I GCAGC 4 cut(s) 61, 114, 497, 579
LweI GCATC 2 cut(s) 16, 142
MaeI CTAG 2 cut(s) 372, 563
MaeIII GTNAC 1 cut(s) 110
MalI GATC 4 cut(s) 210, 237, 311, 582
MboI GATC 4 cut(s) 208, 235, 309, 580
MboII GAAGA 1 cut(s) 416
MfeI CAATTG 1 cut(s) 267
MflI RGATCY 1 cut(s) 580
MhlI GDGCHC 1 cut(s) 358
MmeI TCCRAC 1 cut(s) 182
MnlI CCTC 1 cut(s) 389
MroI TCCGGA 1 cut(s) 160
MseI TTAA 1 cut(s) 183
MslI CAYNNNNRTG 1 cut(s) 150
MspI CCGG 1 cut(s) 161
MspR9I CCNGG 2 cut(s) 60, 198
MunI CAATTG 1 cut(s) 267
Mva1269I GAATGC 1 cut(s) 413
MvaI CCWGG 2 cut(s) 60, 198
MwoI GCNNNNNNNGC 1 cut(s) 545
NdeII GATC 4 cut(s) 208, 235, 309, 580
NlaIII CATG 5 cut(s) 43, 118, 128, 245, 461
NlaIV GGNNCC 1 cut(s) 363
NspI RCATGY 2 cut(s) 43, 245
PaeI GCATGC 1 cut(s) 245
PciI ACATGT 1 cut(s) 39
PctI GAATGC 1 cut(s) 413
PfeI GAWTC 1 cut(s) 506
PkrI GCNGC 4 cut(s) 76, 104, 487, 569
PscI ACATGT 1 cut(s) 39
Psp6I CCWGG 2 cut(s) 58, 196
PspGI CCWGG 2 cut(s) 58, 196
PspN4I GGNNCC 1 cut(s) 363
PspPI GGNCC 1 cut(s) 362
PsuI RGATCY 1 cut(s) 580
RseI CAYNNNNRTG 1 cut(s) 150
SaqAI TTAA 1 cut(s) 183
SatI GCNGC 4 cut(s) 75, 103, 486, 568
Sau3AI GATC 4 cut(s) 208, 235, 309, 580
Sau96I GGNCC 1 cut(s) 362
ScrFI CCNGG 2 cut(s) 60, 198
SduI GDGCHC 1 cut(s) 358
SetI ASST 5 cut(s) 15, 64, 72, 345, 388
SfaNI GCATC 2 cut(s) 16, 142
SfcI CTRYAG 1 cut(s) 593
SinI GGWCC 1 cut(s) 362
SmiMI CAYNNNNRTG 1 cut(s) 150
SphI GCATGC 1 cut(s) 245
SspI AATATT 2 cut(s) 331, 532
SspMI CTAG 2 cut(s) 372, 563
StyD4I CCNGG 2 cut(s) 58, 196
TaaI ACNGT 2 cut(s) 172, 432
TfiI GAWTC 1 cut(s) 506
Tru1I TTAA 1 cut(s) 183
Tru9I TTAA 1 cut(s) 183
TscAI CASTG 2 cut(s) 363, 475
TseI GCWGC 4 cut(s) 74, 102, 485, 567
TspDTI ATGAA 1 cut(s) 474
TspGWI ACGGA 1 cut(s) 436
TspRI CASTG 2 cut(s) 363, 475
VpaK11BI GGWCC 1 cut(s) 362
XapI RAATTY 5 cut(s) 32, 54, 475, 514, 558
XceI RCATGY 2 cut(s) 43, 245
XspI CTAG 2 cut(s) 372, 563
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.