pycom1353g00030

Mini-chromosome maintenance complex-binding

Basic Information

Type: gene
Biological Identity
pyrus_communis
tig00001353
Physical Location & Seq
Reverse (-)
52866 .. 54216
1351 bp
Loading structure...
UTR
Exon/CDS
Intron
pycom1353g00030.2

Sequence Viewer

Length: 213 bp
ATGGGAGTTGAACATCAACAAATTTTGTTGAGGTGCCCAACGGATTTAAAGGTGGTGGGAGCATTTACATGGACTTTCGAAACCAAAACACCACCATCAGGGAGGTTGATCGATCACTACCCCCTCCCATTCATTGAGCCATGTTATGAAAGTGTTGAAGGGCATGTTGTGGAAGAGCTTCCCTTGCATGCCGTGGGTTCCAACTTGGAGTGA
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families

Protein Analysis

71

Amino Acids

7.87

Weight (kDa)

4.99

Isoelectric Point (pI)

47.27

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Orthologous Genes (Group: OG0000437)

Species Orthologous Gene IDs
arabidopsis_thaliana AT2G06105
fragaria_vesca FvH4_1g09709 FvH4_4g02101 FvH4_4g08975 FvH4_6g23372 FvH4_6g39851 FvH4_c1g00300
malus_domestica MD01G1176100.v1.1 MD09G1284900.v1.1 MD15G1306600.v1.1
prunus_persica Prupe.1G227700_v2.0.a1
pyrus_communis pycom01g00630 pycom01g01020 pycom01g01690 pycom01g01760 pycom01g04190 pycom01g04400 pycom02g18130 pycom03g10160 pycom05g06370 pycom05g08930 pycom06g05590 pycom10g06320 pycom11g14330 pycom11g15320 pycom11g16240 pycom12416g00050 pycom12420g00010 pycom12420g00120 pycom12426g00180 pycom12426g00710 pycom12531g00010 pycom1256g00020 pycom1256g00050 pycom1341g00030 pycom1353g00030 pycom13g23070 pycom13g23210 pycom13g26260 pycom13g26370 pycom13g26470 pycom13g26980 pycom14g08550 pycom14g08850 pycom1534g00040 pycom15g28760 pycom15g31230 pycom1604g00040 pycom16g21900 pycom16g26030 pycom1739g00020 pycom1739g00050 pycom17g12970 pycom17g17960 pycom17g18300 pycom17g18650 pycom2172g00020 pycom2438g00020 pycom436g00370 pycom436g00390 pycom576g00050 pycom76g00020
rosa_chinensis RchiOBHm_Chr1g0320811 RchiOBHm_Chr2g0135321 RchiOBHm_Chr3g0485721 RchiOBHm_Chr7g0236571
rosa_multiflora Rmu_sc0000185.1_g000007 Rmu_sc0002094.1_g000030 Rmu_sc0002764.1_g000007 Rmu_sc0002809.1_g000014 Rmu_sc0003005.1_g000007 Rmu_sc0003798.1_g000005 Rmu_sc0004646.1_g000027 Rmu_sc0004665.1_g000009 Rmu_sc0004818.1_g000001 Rmu_sc0004988.1_g000031 Rmu_sc0006373.1_g000007 Rmu_sc0007142.1_g000015 Rmu_sc0009930.1_g000001 Rmu_sc0011451.1_g000001 Rmu_sc0020424.1_g000001 Rmu_sc0036944.1_g000001 Rmu_ssc0000062.1_g000010
rosa_roxburghii Rroxscaffold_2G00123930 Rroxscaffold_3G00231480 Rroxscaffold_6G00413880
rosa_rugosa Rorug04G0084800
rosa_samantha Rh3BG150500 Rh6DG232400
rosa_wichuraiana Rw2G018400 Rw3G027860 Rw4G021220 Rw6G020670 Rw6G037970

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AccB1I GGYRCC 1 cut(s) 33
AcsI RAATTY 1 cut(s) 21
AfiI CCNNNNNNNGG 1 cut(s) 98
AgsI TTSAA 2 cut(s) 11, 158
AluBI AGCT 1 cut(s) 178
AluI AGCT 1 cut(s) 178
ApoI RAATTY 1 cut(s) 21
Asp700I GAANNNNTTC 1 cut(s) 177
AsuII TTCGAA 1 cut(s) 78
BaeGI GKGCMC 1 cut(s) 38
BanI GGYRCC 1 cut(s) 33
BccI CCATC 1 cut(s) 103
BceAI ACGGC 1 cut(s) 176
BmiI GGNNCC 2 cut(s) 35, 199
Bpu14I TTCGAA 1 cut(s) 78
Bsa29I ATCGAT 1 cut(s) 111
BsaJI CCNNGG 1 cut(s) 192
Bsc4I CCNNNNNNNGG 1 cut(s) 98
BseCI ATCGAT 1 cut(s) 111
BseDI CCNNGG 1 cut(s) 192
BseLI CCNNNNNNNGG 1 cut(s) 98
BseSI GKGCMC 1 cut(s) 38
BshNI GGYRCC 1 cut(s) 33
BshVI ATCGAT 1 cut(s) 111
BslI CCNNNNNNNGG 1 cut(s) 98
Bsp119I TTCGAA 1 cut(s) 78
Bsp1286I GDGCHC 1 cut(s) 38
Bsp143I GATC 2 cut(s) 108, 112
BspDI ATCGAT 1 cut(s) 111
BspLI GGNNCC 2 cut(s) 35, 199
BspQI GCTCTTC 1 cut(s) 168
BspT104I TTCGAA 1 cut(s) 78
BspT107I GGYRCC 1 cut(s) 33
BssECI CCNNGG 1 cut(s) 192
BssMI GATC 2 cut(s) 108, 112
Bst6I CTCTTC 1 cut(s) 168
BstBI TTCGAA 1 cut(s) 78
BstC8I GCNNGC 1 cut(s) 189
BstDSI CCRYGG 1 cut(s) 192
BstKTI GATC 2 cut(s) 111, 115
BstMBI GATC 2 cut(s) 108, 112
BstMWI GCNNNNNNNGC 1 cut(s) 184
BstNSI RCATGY 2 cut(s) 167, 191
BstSLI GKGCMC 1 cut(s) 38
Bsu15I ATCGAT 1 cut(s) 111
BsuTUI ATCGAT 1 cut(s) 111
BtgI CCRYGG 1 cut(s) 192
Cac8I GCNNGC 1 cut(s) 189
ClaI ATCGAT 1 cut(s) 111
CviAII CATG 4 cut(s) 69, 141, 164, 188
CviJI RGCY 2 cut(s) 139, 178
CviKI_1 RGCY 2 cut(s) 139, 178
DpnI GATC 2 cut(s) 110, 114
DpnII GATC 2 cut(s) 108, 112
DraI TTTAAA 1 cut(s) 48
Eam1104I CTCTTC 1 cut(s) 168
EarI CTCTTC 1 cut(s) 168
FaeI CATG 4 cut(s) 72, 144, 167, 191
FaiI YATR 5 cut(s) 70, 142, 147, 165, 189
FatI CATG 4 cut(s) 68, 140, 163, 187
Hin1II CATG 4 cut(s) 72, 144, 167, 191
HpyAV CCTTC 1 cut(s) 152
HpyCH4V TGCA 1 cut(s) 187
HpyF10VI GCNNNNNNNGC 1 cut(s) 184
Hsp92II CATG 4 cut(s) 72, 144, 167, 191
Kzo9I GATC 2 cut(s) 108, 112
LguI GCTCTTC 1 cut(s) 168
LmnI GCTCC 1 cut(s) 59
LpnPI CCDG 1 cut(s) 84
MalI GATC 2 cut(s) 110, 114
MboI GATC 2 cut(s) 108, 112
MboII GAAGA 1 cut(s) 185
MhlI GDGCHC 1 cut(s) 38
MluCI AATT 1 cut(s) 21
MnlI CCTC 3 cut(s) 24, 96, 134
MroXI GAANNNNTTC 1 cut(s) 177
MseI TTAA 1 cut(s) 47
MslI CAYNNNNRTG 1 cut(s) 67
MwoI GCNNNNNNNGC 1 cut(s) 184
NdeII GATC 2 cut(s) 108, 112
NlaIII CATG 4 cut(s) 72, 144, 167, 191
NlaIV GGNNCC 2 cut(s) 35, 199
NspI RCATGY 2 cut(s) 167, 191
NspV TTCGAA 1 cut(s) 78
PaeI GCATGC 1 cut(s) 191
PciSI GCTCTTC 1 cut(s) 168
PdmI GAANNNNTTC 1 cut(s) 177
PspN4I GGNNCC 2 cut(s) 35, 199
RseI CAYNNNNRTG 1 cut(s) 67
SapI GCTCTTC 1 cut(s) 168
SaqAI TTAA 1 cut(s) 47
Sau3AI GATC 2 cut(s) 108, 112
SduI GDGCHC 1 cut(s) 38
SetI ASST 4 cut(s) 35, 54, 107, 180
SfuI TTCGAA 1 cut(s) 78
SgeI CNNG 7 cut(s) 81, 111, 153, 176, 196, 200, 205
SmiMI CAYNNNNRTG 1 cut(s) 67
SphI GCATGC 1 cut(s) 191
Sse9I AATT 1 cut(s) 21
TaqI TCGA 2 cut(s) 78, 111
TasI AATT 1 cut(s) 21
Tru1I TTAA 1 cut(s) 47
Tru9I TTAA 1 cut(s) 47
TspDTI ATGAA 2 cut(s) 121, 162
TspGWI ACGGA 1 cut(s) 56
XapI RAATTY 1 cut(s) 21
XceI RCATGY 2 cut(s) 167, 191
XmnI GAANNNNTTC 1 cut(s) 177
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.