Rmu_sc0006373.1_g000007

transposition, RNA-mediated

Design Primers CRISPR Design

Basic Information

Type: gene
Biological Identity
rosa_multiflora
Rmu_sc0006373.1
OG0000437
Physical Location & Seq
Reverse (-)
39175 .. 39498
324 bp
Loading structure...
UTR
Exon/CDS
Intron
Rmu_sc0006373.1_g000007.1.cds

Sequence Viewer

Length: 324 bp
atgtctgaagtgcatgatattttaaagaaggtcaatgtcaatatacatttgattgagcttcttcgacaaatgccggtttatgcaaaatttctaaaggacttgtgcacccataagaggaggataaagaatgatgagctgttcgagatttgtgaggaggttagtgctatcttgcaaagacagattccccaaaaactcaaggattcggggagcttcaatatctcttgcactattggtgagaaagtctttgatagagctttgatggaccttggttcaagactattggtgagaaagtctttgatagagcgaccttggttcaagtgttaa
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families
Retrotrans_gag rve

Protein Analysis

107

Amino Acids

12.57

Weight (kDa)

9.18

Isoelectric Point (pI)

76.9

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready
iTOL Interactive Tree Of Life · Most popular EvolView Flexible annotations MEGA Desktop phylogenetics suite FigTree Desktop tree editor

Orthologous Genes (Group: OG0000437)

Species Orthologous Gene IDs
arabidopsis_thaliana AT2G06105
fragaria_vesca FvH4_1g09709 FvH4_4g02101 FvH4_4g08975 FvH4_6g23372 FvH4_6g39851 FvH4_c1g00300
malus_domestica MD01G1176100.v1.1 MD09G1284900.v1.1 MD15G1306600.v1.1
prunus_persica Prupe.1G227700_v2.0.a1
pyrus_communis pycom01g00630 pycom01g01020 pycom01g01690 pycom01g01760 pycom01g04190 pycom01g04400 pycom02g18130 pycom03g10160 pycom05g06370 pycom05g08930 pycom06g05590 pycom10g06320 pycom11g14330 pycom11g15320 pycom11g16240 pycom12416g00050 pycom12420g00010 pycom12420g00120 pycom12426g00180 pycom12426g00710 pycom12531g00010 pycom1256g00020 pycom1256g00050 pycom1341g00030 pycom1353g00030 pycom13g23070 pycom13g23210 pycom13g26260 pycom13g26370 pycom13g26470 pycom13g26980 pycom14g08550 pycom14g08850 pycom1534g00040 pycom15g28760 pycom15g31230 pycom1604g00040 pycom16g21900 pycom16g26030 pycom1739g00020 pycom1739g00050 pycom17g12970 pycom17g17960 pycom17g18300 pycom17g18650 pycom2172g00020 pycom2438g00020 pycom436g00370 pycom436g00390 pycom576g00050 pycom76g00020
rosa_chinensis RchiOBHm_Chr1g0320811 RchiOBHm_Chr2g0135321 RchiOBHm_Chr3g0485721 RchiOBHm_Chr7g0236571
rosa_multiflora Rmu_sc0000185.1_g000007 Rmu_sc0002094.1_g000030 Rmu_sc0002764.1_g000007 Rmu_sc0002809.1_g000014 Rmu_sc0003005.1_g000007 Rmu_sc0003798.1_g000005 Rmu_sc0004646.1_g000027 Rmu_sc0004665.1_g000009 Rmu_sc0004818.1_g000001 Rmu_sc0004988.1_g000031 Rmu_sc0006373.1_g000007 Rmu_sc0007142.1_g000015 Rmu_sc0009930.1_g000001 Rmu_sc0011451.1_g000001 Rmu_sc0020424.1_g000001 Rmu_sc0036944.1_g000001 Rmu_ssc0000062.1_g000010
rosa_roxburghii Rroxscaffold_2G00123930 Rroxscaffold_3G00231480 Rroxscaffold_6G00413880
rosa_rugosa Rorug04G0084800
rosa_samantha Rh3BG150500 Rh6DG232400
rosa_wichuraiana Rw2G018400 Rw3G027860 Rw4G021220 Rw6G020670 Rw6G037970

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AcsI RAATTY 1 cut(s) 86
AcuI CTGAAG 1 cut(s) 27
AfiI CCNNNNNNNGG 1 cut(s) 114
AgsI TTSAA 3 cut(s) 214, 273, 316
AluBI AGCT 4 cut(s) 58, 136, 210, 254
AluI AGCT 4 cut(s) 58, 136, 210, 254
Alw21I GWGCWC 1 cut(s) 107
Alw44I GTGCAC 1 cut(s) 103
ApaLI GTGCAC 1 cut(s) 103
ApoI RAATTY 1 cut(s) 86
AspS9I GGNCC 1 cut(s) 262
AsuHPI GGTGA 2 cut(s) 245, 295
AvaII GGWCC 1 cut(s) 262
BaeGI GKGCMC 1 cut(s) 107
Bbv12I GWGCWC 1 cut(s) 107
BccI CCATC 1 cut(s) 253
Bme18I GGWCC 1 cut(s) 262
BmgT120I GGNCC 1 cut(s) 262
BpuEI CTTGAG 1 cut(s) 179
BsaJI CCNNGG 2 cut(s) 265, 308
Bsc4I CCNNNNNNNGG 1 cut(s) 114
Bse118I RCCGGY 1 cut(s) 73
BseDI CCNNGG 2 cut(s) 265, 308
BseLI CCNNNNNNNGG 1 cut(s) 114
BseRI GAGGAG 2 cut(s) 130, 167
BseSI GKGCMC 1 cut(s) 107
BsiHKAI GWGCWC 1 cut(s) 107
BsiSI CCGG 1 cut(s) 74
BslI CCNNNNNNNGG 1 cut(s) 114
Bsp1286I GDGCHC 1 cut(s) 107
BsrFI RCCGGY 1 cut(s) 73
BssAI RCCGGY 1 cut(s) 73
BssECI CCNNGG 2 cut(s) 265, 308
BssT1I CCWWGG 2 cut(s) 265, 308
BstSLI GKGCMC 1 cut(s) 107
Cfr10I RCCGGY 1 cut(s) 73
Cfr13I GGNCC 1 cut(s) 262
CviAII CATG 1 cut(s) 14
CviJI RGCY 4 cut(s) 58, 136, 210, 254
CviKI_1 RGCY 4 cut(s) 58, 136, 210, 254
DraI TTTAAA 1 cut(s) 24
Eco130I CCWWGG 2 cut(s) 265, 308
Eco47I GGWCC 1 cut(s) 262
Eco57I CTGAAG 1 cut(s) 27
EcoT14I CCWWGG 2 cut(s) 265, 308
ErhI CCWWGG 2 cut(s) 265, 308
FaeI CATG 1 cut(s) 17
FaiI YATR 4 cut(s) 15, 44, 81, 111
FatI CATG 1 cut(s) 13
HapII CCGG 1 cut(s) 74
Hin1II CATG 1 cut(s) 17
HinfI GANTC 2 cut(s) 181, 200
HpaII CCGG 1 cut(s) 74
HphI GGTGA 2 cut(s) 245, 295
Hpy166II GTNNAC 1 cut(s) 105
Hpy188I TCNGA 1 cut(s) 7
Hpy188III TCNNGA 2 cut(s) 142, 273
Hpy8I GTNNAC 1 cut(s) 105
HpyAV CCTTC 1 cut(s) 22
HpyCH4V TGCA 5 cut(s) 13, 83, 105, 172, 225
Hsp92II CATG 1 cut(s) 17
LmnI GCTCC 1 cut(s) 207
LpnPI CCDG 1 cut(s) 87
MboII GAAGA 1 cut(s) 53
MhlI GDGCHC 1 cut(s) 107
MluCI AATT 1 cut(s) 86
MnlI CCTC 4 cut(s) 108, 111, 145, 148
MseI TTAA 2 cut(s) 23, 322
MspI CCGG 1 cut(s) 74
NlaIII CATG 1 cut(s) 17
PfeI GAWTC 2 cut(s) 181, 200
PspPI GGNCC 1 cut(s) 262
SaqAI TTAA 2 cut(s) 23, 322
Sau96I GGNCC 1 cut(s) 262
SduI GDGCHC 1 cut(s) 107
SetI ASST 8 cut(s) 33, 60, 138, 159, 212, 256, 267, 310
SinI GGWCC 1 cut(s) 262
SmlI CTYRAG 1 cut(s) 194
SmoI CTYRAG 1 cut(s) 194
Sse9I AATT 1 cut(s) 86
StyI CCWWGG 2 cut(s) 265, 308
TaqI TCGA 2 cut(s) 64, 141
TasI AATT 1 cut(s) 86
TfiI GAWTC 2 cut(s) 181, 200
Tru1I TTAA 2 cut(s) 23, 322
Tru9I TTAA 2 cut(s) 23, 322
VneI GTGCAC 1 cut(s) 103
VpaK11BI GGWCC 1 cut(s) 262
XapI RAATTY 1 cut(s) 86
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.