Rmu_sc0004818.1_g000001

transposition, RNA-mediated

Design Primers CRISPR Design

Basic Information

Type: gene
Biological Identity
rosa_multiflora
Rmu_sc0004818.1
OG0000437
Physical Location & Seq
Forward (+)
715 .. 1113
399 bp
Loading structure...
UTR
Exon/CDS
Intron
Rmu_sc0004818.1_g000001.1.cds

Sequence Viewer

Length: 399 bp
atgggcaataggtctaaggcatctcctcaggtatgctctgtttgctcatatactgaccatactactgacatgtgtcctatgtctgctttgtcagaggaacaaatgaactttgtggagcaactaaggcaaaagtacgaccccttccctaacacatacaatcaaggatggaaagatcacccaaattttgtttggagcaacaacgataatgtggttcgacctactcaaggtgattacaatgcaccactgagattccaagctactaaacaacaagcatatcaacaagctccacctcaacaaagatttggcaagtcactagaggatatggtcaaggagatgacacttcacaccgctaccttgaagagcacaactgtcacattcatgcaagagaccaaggcttaa
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families
Asp_protease_2 RVT_1 Retrotrans_gag rve

Protein Analysis

132

Amino Acids

15.18

Weight (kDa)

6.81

Isoelectric Point (pI)

46.23

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready
iTOL Interactive Tree Of Life · Most popular EvolView Flexible annotations MEGA Desktop phylogenetics suite FigTree Desktop tree editor

Orthologous Genes (Group: OG0000437)

Species Orthologous Gene IDs
arabidopsis_thaliana AT2G06105
fragaria_vesca FvH4_1g09709 FvH4_4g02101 FvH4_4g08975 FvH4_6g23372 FvH4_6g39851 FvH4_c1g00300
malus_domestica MD01G1176100.v1.1 MD09G1284900.v1.1 MD15G1306600.v1.1
prunus_persica Prupe.1G227700_v2.0.a1
pyrus_communis pycom01g00630 pycom01g01020 pycom01g01690 pycom01g01760 pycom01g04190 pycom01g04400 pycom02g18130 pycom03g10160 pycom05g06370 pycom05g08930 pycom06g05590 pycom10g06320 pycom11g14330 pycom11g15320 pycom11g16240 pycom12416g00050 pycom12420g00010 pycom12420g00120 pycom12426g00180 pycom12426g00710 pycom12531g00010 pycom1256g00020 pycom1256g00050 pycom1341g00030 pycom1353g00030 pycom13g23070 pycom13g23210 pycom13g26260 pycom13g26370 pycom13g26470 pycom13g26980 pycom14g08550 pycom14g08850 pycom1534g00040 pycom15g28760 pycom15g31230 pycom1604g00040 pycom16g21900 pycom16g26030 pycom1739g00020 pycom1739g00050 pycom17g12970 pycom17g17960 pycom17g18300 pycom17g18650 pycom2172g00020 pycom2438g00020 pycom436g00370 pycom436g00390 pycom576g00050 pycom76g00020
rosa_chinensis RchiOBHm_Chr1g0320811 RchiOBHm_Chr2g0135321 RchiOBHm_Chr3g0485721 RchiOBHm_Chr7g0236571
rosa_multiflora Rmu_sc0000185.1_g000007 Rmu_sc0002094.1_g000030 Rmu_sc0002764.1_g000007 Rmu_sc0002809.1_g000014 Rmu_sc0003005.1_g000007 Rmu_sc0003798.1_g000005 Rmu_sc0004646.1_g000027 Rmu_sc0004665.1_g000009 Rmu_sc0004818.1_g000001 Rmu_sc0004988.1_g000031 Rmu_sc0006373.1_g000007 Rmu_sc0007142.1_g000015 Rmu_sc0009930.1_g000001 Rmu_sc0011451.1_g000001 Rmu_sc0020424.1_g000001 Rmu_sc0036944.1_g000001 Rmu_ssc0000062.1_g000010
rosa_roxburghii Rroxscaffold_2G00123930 Rroxscaffold_3G00231480 Rroxscaffold_6G00413880
rosa_rugosa Rorug04G0084800
rosa_samantha Rh3BG150500 Rh6DG232400
rosa_wichuraiana Rw2G018400 Rw3G027860 Rw4G021220 Rw6G020670 Rw6G037970

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AciI CCGC 1 cut(s) 348
AcsI RAATTY 1 cut(s) 181
AfaI GTAC 1 cut(s) 134
AfiI CCNNNNNNNGG 1 cut(s) 224
AflIII ACRYGT 1 cut(s) 69
AgsI TTSAA 1 cut(s) 358
AluBI AGCT 2 cut(s) 257, 284
AluI AGCT 2 cut(s) 257, 284
Alw21I GWGCWC 1 cut(s) 365
Alw26I GTCTC 1 cut(s) 380
ApoI RAATTY 1 cut(s) 181
AsuHPI GGTGA 2 cut(s) 167, 239
AxyI CCTNAGG 1 cut(s) 27
BarI GAAGNNNNNNTAC 2 cut(s) 125, 157
Bbv12I GWGCWC 1 cut(s) 365
BccI CCATC 1 cut(s) 159
BcoDI GTCTC 1 cut(s) 380
BfaI CTAG 1 cut(s) 314
BmsI GCATC 1 cut(s) 29
BoxI GACNNNNGTC 1 cut(s) 72
BpuEI CTTGAG 1 cut(s) 207
BsaI GGTCTC 1 cut(s) 380
BsaJI CCNNGG 1 cut(s) 390
Bsc4I CCNNNNNNNGG 1 cut(s) 224
Bse21I CCTNAGG 1 cut(s) 27
BseDI CCNNGG 1 cut(s) 390
BseGI GGATG 1 cut(s) 170
BseLI CCNNNNNNNGG 1 cut(s) 224
BseMII CTCAG 2 cut(s) 41, 236
BseRI GAGGAG 1 cut(s) 15
BsiHKAI GWGCWC 1 cut(s) 365
BslI CCNNNNNNNGG 1 cut(s) 224
BsmAI GTCTC 1 cut(s) 380
Bso31I GGTCTC 1 cut(s) 380
Bsp1286I GDGCHC 1 cut(s) 365
Bsp143I GATC 1 cut(s) 172
BspACI CCGC 1 cut(s) 348
BspCNI CTCAG 2 cut(s) 40, 237
BspQI GCTCTTC 1 cut(s) 353
BspTNI GGTCTC 1 cut(s) 380
BssECI CCNNGG 1 cut(s) 390
BssMI GATC 1 cut(s) 172
BssT1I CCWWGG 1 cut(s) 390
Bst4CI ACNGT 1 cut(s) 370
Bst6I CTCTTC 1 cut(s) 353
BstDEI CTNAG 4 cut(s) 15, 27, 122, 245
BstENI CCTNNNNNAGG 1 cut(s) 222
BstF5I GGATG 1 cut(s) 170
BstKTI GATC 1 cut(s) 175
BstMAI GTCTC 1 cut(s) 380
BstMBI GATC 1 cut(s) 172
BstMWI GCNNNNNNNGC 2 cut(s) 42, 124
BstNSI RCATGY 1 cut(s) 73
BstPAI GACNNNNGTC 1 cut(s) 72
Bsu36I CCTNAGG 1 cut(s) 27
BtsCI GGATG 1 cut(s) 170
BtsIMutI CAGTG 1 cut(s) 242
Csp6I GTAC 1 cut(s) 133
CviAII CATG 2 cut(s) 70, 379
CviJI RGCY 3 cut(s) 257, 284, 395
CviKI_1 RGCY 3 cut(s) 257, 284, 395
CviQI GTAC 1 cut(s) 133
DdeI CTNAG 4 cut(s) 15, 27, 122, 245
DpnI GATC 1 cut(s) 174
DpnII GATC 1 cut(s) 172
Eam1104I CTCTTC 1 cut(s) 353
EarI CTCTTC 1 cut(s) 353
Eco130I CCWWGG 1 cut(s) 390
Eco31I GGTCTC 1 cut(s) 380
Eco81I CCTNAGG 1 cut(s) 27
EcoNI CCTNNNNNAGG 1 cut(s) 222
EcoT14I CCWWGG 1 cut(s) 390
ErhI CCWWGG 1 cut(s) 390
FaeI CATG 2 cut(s) 73, 382
FatI CATG 2 cut(s) 69, 378
FokI GGATG 1 cut(s) 177
FspBI CTAG 1 cut(s) 314
Hin1II CATG 2 cut(s) 73, 382
HinfI GANTC 1 cut(s) 249
HphI GGTGA 2 cut(s) 167, 239
Hpy188I TCNGA 1 cut(s) 94
HpyAV CCTTC 1 cut(s) 151
HpyCH4III ACNGT 1 cut(s) 370
HpyCH4V TGCA 2 cut(s) 239, 382
HpyF10VI GCNNNNNNNGC 2 cut(s) 42, 124
HpyF3I CTNAG 4 cut(s) 15, 27, 122, 245
Hsp92II CATG 2 cut(s) 73, 382
Kzo9I GATC 1 cut(s) 172
LguI GCTCTTC 1 cut(s) 353
LmnI GCTCC 3 cut(s) 115, 192, 289
LpnPI CCDG 1 cut(s) 14
LweI GCATC 1 cut(s) 29
MaeI CTAG 1 cut(s) 314
MaeIII GTNAC 2 cut(s) 309, 370
MalI GATC 1 cut(s) 174
MboI GATC 1 cut(s) 172
MboII GAAGA 1 cut(s) 370
MhlI GDGCHC 1 cut(s) 365
MluCI AATT 1 cut(s) 181
MnlI CCTC 4 cut(s) 36, 88, 300, 310
MseI TTAA 1 cut(s) 397
MslI CAYNNNNRTG 1 cut(s) 377
MwoI GCNNNNNNNGC 2 cut(s) 42, 124
NdeII GATC 1 cut(s) 172
NlaIII CATG 2 cut(s) 73, 382
NmuCI GTSAC 2 cut(s) 309, 370
NspI RCATGY 1 cut(s) 73
PciI ACATGT 1 cut(s) 69
PciSI GCTCTTC 1 cut(s) 353
PfeI GAWTC 1 cut(s) 249
PscI ACATGT 1 cut(s) 69
PshAI GACNNNNGTC 1 cut(s) 72
RsaI GTAC 1 cut(s) 134
RsaNI GTAC 1 cut(s) 133
RseI CAYNNNNRTG 1 cut(s) 377
SapI GCTCTTC 1 cut(s) 353
SaqAI TTAA 1 cut(s) 397
Sau3AI GATC 1 cut(s) 172
SduI GDGCHC 1 cut(s) 365
SetI ASST 8 cut(s) 14, 33, 220, 229, 259, 286, 292, 356
SfaNI GCATC 1 cut(s) 29
SmiMI CAYNNNNRTG 1 cut(s) 377
SmlI CTYRAG 1 cut(s) 222
SmoI CTYRAG 1 cut(s) 222
Sse9I AATT 1 cut(s) 181
SsiI CCGC 1 cut(s) 348
SspMI CTAG 1 cut(s) 314
StyI CCWWGG 1 cut(s) 390
TaaI ACNGT 1 cut(s) 370
TaqI TCGA 1 cut(s) 214
TasI AATT 1 cut(s) 181
TfiI GAWTC 1 cut(s) 249
Tru1I TTAA 1 cut(s) 397
Tru9I TTAA 1 cut(s) 397
TscAI CASTG 1 cut(s) 249
TseFI GTSAC 2 cut(s) 309, 370
Tsp45I GTSAC 2 cut(s) 309, 370
TspDTI ATGAA 2 cut(s) 119, 367
TspRI CASTG 1 cut(s) 249
XagI CCTNNNNNAGG 1 cut(s) 222
XapI RAATTY 1 cut(s) 181
XceI RCATGY 1 cut(s) 73
XcmI CCANNNNNNNNNTGG 1 cut(s) 186
XspI CTAG 1 cut(s) 314
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.