Rmu_sc0002764.1_g000007

transposition, RNA-mediated

Design Primers CRISPR Design

Basic Information

Type: gene
Biological Identity
rosa_multiflora
Rmu_sc0002764.1
OG0000437
Physical Location & Seq
Reverse (-)
30246 .. 31022
777 bp
Loading structure...
UTR
Exon/CDS
Intron
Rmu_sc0002764.1_g000007.1.cds

Sequence Viewer

Length: 777 bp
atgatggcggcctttgtgaacaatcaagcaaagcaagatgagaagatcaatgtcatccaacaaagtatgagcaagcttgaggtacaaatagggcaactagcccatgagttgagccaaaggaagcaaggagtgtttccaagtcaagtggtcaacaatccaaggcatgaagccaaggccatcactattttgagaagtggaagtccagttgagaacaatgtgtacatgcccactattgaagaagttgtaactccaagagagccaccaggttttgaaaggagattaaagcatgagcaagttgttttggattacaatgaaggacaagataaggtcttgaaaaacaactcaaattccaaggccaaccatgaaaaagaagtgtccaatgatcatccaatcaatagaccattccaaataggtatcactttcaatcctcctttgaagattgtgcaagaagaagaagtgtctctcccttaccctcgagctatatggcaacaagagaaaaaactcaagaaagagagccaattgagggagatgattgattttttcaagaaggttcatataaacattccactccttgaagccgtgaagacaatcccatcttatgctaagttcttgaaggatatgcgcatgaagaagaaaaagttcaaagaacatgagcaagtggctatttgtgaagaagtgagtgctattagtcaaagaaagcttccaccaaagctcaaaaatcagggaagcttcactattccaagcaagattggagaaactactttgacaattgcttga
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families
Asp_protease_2 Retrotrans_gag

Protein Analysis

258

Amino Acids

29.64

Weight (kDa)

9.45

Isoelectric Point (pI)

46.71

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready
iTOL Interactive Tree Of Life · Most popular EvolView Flexible annotations MEGA Desktop phylogenetics suite FigTree Desktop tree editor

Orthologous Genes (Group: OG0000437)

Species Orthologous Gene IDs
arabidopsis_thaliana AT2G06105
fragaria_vesca FvH4_1g09709 FvH4_4g02101 FvH4_4g08975 FvH4_6g23372 FvH4_6g39851 FvH4_c1g00300
malus_domestica MD01G1176100.v1.1 MD09G1284900.v1.1 MD15G1306600.v1.1
prunus_persica Prupe.1G227700_v2.0.a1
pyrus_communis pycom01g00630 pycom01g01020 pycom01g01690 pycom01g01760 pycom01g04190 pycom01g04400 pycom02g18130 pycom03g10160 pycom05g06370 pycom05g08930 pycom06g05590 pycom10g06320 pycom11g14330 pycom11g15320 pycom11g16240 pycom12416g00050 pycom12420g00010 pycom12420g00120 pycom12426g00180 pycom12426g00710 pycom12531g00010 pycom1256g00020 pycom1256g00050 pycom1341g00030 pycom1353g00030 pycom13g23070 pycom13g23210 pycom13g26260 pycom13g26370 pycom13g26470 pycom13g26980 pycom14g08550 pycom14g08850 pycom1534g00040 pycom15g28760 pycom15g31230 pycom1604g00040 pycom16g21900 pycom16g26030 pycom1739g00020 pycom1739g00050 pycom17g12970 pycom17g17960 pycom17g18300 pycom17g18650 pycom2172g00020 pycom2438g00020 pycom436g00370 pycom436g00390 pycom576g00050 pycom76g00020
rosa_chinensis RchiOBHm_Chr1g0320811 RchiOBHm_Chr2g0135321 RchiOBHm_Chr3g0485721 RchiOBHm_Chr7g0236571
rosa_multiflora Rmu_sc0000185.1_g000007 Rmu_sc0002094.1_g000030 Rmu_sc0002764.1_g000007 Rmu_sc0002809.1_g000014 Rmu_sc0003005.1_g000007 Rmu_sc0003798.1_g000005 Rmu_sc0004646.1_g000027 Rmu_sc0004665.1_g000009 Rmu_sc0004818.1_g000001 Rmu_sc0004988.1_g000031 Rmu_sc0006373.1_g000007 Rmu_sc0007142.1_g000015 Rmu_sc0009930.1_g000001 Rmu_sc0011451.1_g000001 Rmu_sc0020424.1_g000001 Rmu_sc0036944.1_g000001 Rmu_ssc0000062.1_g000010
rosa_roxburghii Rroxscaffold_2G00123930 Rroxscaffold_3G00231480 Rroxscaffold_6G00413880
rosa_rugosa Rorug04G0084800
rosa_samantha Rh3BG150500 Rh6DG232400
rosa_wichuraiana Rw2G018400 Rw3G027860 Rw4G021220 Rw6G020670 Rw6G037970

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
Acc16I TGCGCA 1 cut(s) 623
AciI CCGC 1 cut(s) 8
AcsI RAATTY 1 cut(s) 346
AfaI GTAC 2 cut(s) 84, 221
AfiI CCNNNNNNNGG 1 cut(s) 523
AgsI TTSAA 9 cut(s) 236, 272, 334, 424, 436, 544, 575, 613, 643
AjnI CCWGG 1 cut(s) 262
AluBI AGCT 5 cut(s) 76, 479, 700, 712, 729
AluI AGCT 5 cut(s) 76, 479, 700, 712, 729
Alw26I GTCTC 1 cut(s) 465
Ama87I CYCGRG 1 cut(s) 474
AoxI GGCC 3 cut(s) 9, 174, 354
ApoI RAATTY 1 cut(s) 346
Asp700I GAANNNNTTC 1 cut(s) 638
AspLEI GCGC 1 cut(s) 624
AvaI CYCGRG 1 cut(s) 474
BbsI GAAGAC 1 cut(s) 590
BccI CCATC 2 cut(s) 185, 601
BceAI ACGGC 1 cut(s) 563
BciT130I CCWGG 1 cut(s) 264
BclI TGATCA 1 cut(s) 382
BcoDI GTCTC 1 cut(s) 465
BfaI CTAG 1 cut(s) 98
BisI GCNGC 1 cut(s) 9
BlsI GCNGC 1 cut(s) 10
Bme1390I CCNGG 1 cut(s) 264
BmeT110I CYCGRG 1 cut(s) 474
BmrFI CCNGG 1 cut(s) 264
BpiI GAAGAC 1 cut(s) 590
BpuEI CTTGAG 2 cut(s) 98, 488
BsaJI CCNNGG 3 cut(s) 158, 171, 351
Bsc4I CCNNNNNNNGG 1 cut(s) 523
Bse1I ACTGG 1 cut(s) 203
BseBI CCWGG 1 cut(s) 264
BseDI CCNNGG 3 cut(s) 158, 171, 351
BseGI GGATG 2 cut(s) 54, 385
BseLI CCNNNNNNNGG 1 cut(s) 523
BseNI ACTGG 1 cut(s) 203
BshFI GGCC 3 cut(s) 11, 176, 356
BsiHKCI CYCGRG 1 cut(s) 474
BslI CCNNNNNNNGG 1 cut(s) 523
BsmAI GTCTC 1 cut(s) 465
BsnI GGCC 3 cut(s) 11, 176, 356
BsoBI CYCGRG 1 cut(s) 474
Bsp1407I TGTACA 1 cut(s) 219
Bsp143I GATC 2 cut(s) 45, 382
BspACI CCGC 1 cut(s) 8
BspANI GGCC 3 cut(s) 11, 176, 356
BsrGI TGTACA 1 cut(s) 219
BsrI ACTGG 1 cut(s) 203
BssECI CCNNGG 3 cut(s) 158, 171, 351
BssMI GATC 2 cut(s) 45, 382
BssT1I CCWWGG 3 cut(s) 158, 171, 351
Bst2UI CCWGG 1 cut(s) 264
BstAUI TGTACA 1 cut(s) 219
BstC8I GCNNGC 1 cut(s) 74
BstDEI CTNAG 1 cut(s) 603
BstF5I GGATG 2 cut(s) 54, 385
BstHHI GCGC 1 cut(s) 624
BstKTI GATC 2 cut(s) 48, 385
BstMAI GTCTC 1 cut(s) 465
BstMBI GATC 2 cut(s) 45, 382
BstNI CCWGG 1 cut(s) 264
BstNSI RCATGY 1 cut(s) 226
BstSCI CCNGG 1 cut(s) 262
BstV2I GAAGAC 1 cut(s) 590
BsuRI GGCC 3 cut(s) 11, 176, 356
BtsCI GGATG 2 cut(s) 54, 385
Cac8I GCNNGC 1 cut(s) 74
CfoI GCGC 1 cut(s) 624
CsiI ACCWGGT 1 cut(s) 262
Csp6I GTAC 2 cut(s) 83, 220
CspCI CAANNNNNGTGG 2 cut(s) 126, 161
CviAII CATG 7 cut(s) 104, 164, 223, 287, 362, 625, 650
CviQI GTAC 2 cut(s) 83, 220
DdeI CTNAG 1 cut(s) 603
DpnI GATC 2 cut(s) 47, 384
DpnII GATC 2 cut(s) 45, 382
Eco130I CCWWGG 3 cut(s) 158, 171, 351
Eco88I CYCGRG 1 cut(s) 474
EcoRII CCWGG 1 cut(s) 262
EcoT14I CCWWGG 3 cut(s) 158, 171, 351
ErhI CCWWGG 3 cut(s) 158, 171, 351
FaeI CATG 7 cut(s) 107, 167, 226, 290, 365, 628, 653
FatI CATG 7 cut(s) 103, 163, 222, 286, 361, 624, 649
FbaI TGATCA 1 cut(s) 382
Fnu4HI GCNGC 1 cut(s) 9
FokI GGATG 2 cut(s) 41, 372
Fsp4HI GCNGC 1 cut(s) 9
FspAI RTGCGCAY 1 cut(s) 623
FspBI CTAG 1 cut(s) 98
FspI TGCGCA 1 cut(s) 623
GlaI GCGC 1 cut(s) 623
GluI GCNGC 1 cut(s) 9
HaeIII GGCC 3 cut(s) 11, 176, 356
HhaI GCGC 1 cut(s) 624
Hin1II CATG 7 cut(s) 107, 167, 226, 290, 365, 628, 653
Hin6I GCGC 1 cut(s) 622
HinP1I GCGC 1 cut(s) 622
HincII GTYRAC 1 cut(s) 151
HindII GTYRAC 1 cut(s) 151
HindIII AAGCTT 3 cut(s) 74, 698, 727
Hpy166II GTNNAC 3 cut(s) 19, 151, 220
Hpy188III TCNNGA 4 cut(s) 331, 505, 544, 610
Hpy8I GTNNAC 3 cut(s) 19, 151, 220
HpyAV CCTTC 3 cut(s) 308, 541, 607
HpyCH4V TGCA 1 cut(s) 445
HpyF3I CTNAG 1 cut(s) 603
Hsp92II CATG 7 cut(s) 107, 167, 226, 290, 365, 628, 653
HspAI GCGC 1 cut(s) 622
Ksp22I TGATCA 1 cut(s) 382
Kzo9I GATC 2 cut(s) 45, 382
LpnPI CCDG 4 cut(s) 216, 249, 276, 707
MabI ACCWGGT 1 cut(s) 262
MaeI CTAG 1 cut(s) 98
MaeIII GTNAC 1 cut(s) 244
MalI GATC 2 cut(s) 47, 384
MboI GATC 2 cut(s) 45, 382
MboII GAAGA 9 cut(s) 55, 248, 448, 461, 464, 595, 640, 643, 683
MfeI CAATTG 2 cut(s) 518, 768
MluCI AATT 3 cut(s) 346, 518, 768
MmeI TCCRAC 1 cut(s) 82
MnlI CCTC 4 cut(s) 73, 438, 483, 516
MroXI GAANNNNTTC 1 cut(s) 638
MseI TTAA 1 cut(s) 281
MspR9I CCNGG 1 cut(s) 264
MunI CAATTG 2 cut(s) 518, 768
MvaI CCWGG 1 cut(s) 264
NdeII GATC 2 cut(s) 45, 382
NlaIII CATG 7 cut(s) 107, 167, 226, 290, 365, 628, 653
NsbI TGCGCA 1 cut(s) 623
NspI RCATGY 1 cut(s) 226
PaeR7I CTCGAG 1 cut(s) 474
PdmI GAANNNNTTC 1 cut(s) 638
PkrI GCNGC 1 cut(s) 10
Psp6I CCWGG 1 cut(s) 262
PspGI CCWGG 1 cut(s) 262
PspXI VCTCGAGB 1 cut(s) 474
PsrI GAACNNNNNNTAC 2 cut(s) 203, 235
RsaI GTAC 2 cut(s) 84, 221
RsaNI GTAC 2 cut(s) 83, 220
SaqAI TTAA 1 cut(s) 281
SatI GCNGC 1 cut(s) 9
Sau3AI GATC 2 cut(s) 45, 382
ScrFI CCNGG 1 cut(s) 264
SexAI ACCWGGT 1 cut(s) 262
Sfr274I CTCGAG 1 cut(s) 474
SlaI CTCGAG 1 cut(s) 474
SmlI CTYRAG 3 cut(s) 77, 474, 503
SmoI CTYRAG 3 cut(s) 77, 474, 503
Sse9I AATT 3 cut(s) 346, 518, 768
SsiI CCGC 1 cut(s) 8
SspMI CTAG 1 cut(s) 98
StyD4I CCNGG 1 cut(s) 262
StyI CCWWGG 3 cut(s) 158, 171, 351
TaqI TCGA 1 cut(s) 475
TasI AATT 3 cut(s) 346, 518, 768
TatI WGTACW 1 cut(s) 219
TauI GCSGC 1 cut(s) 11
Tru1I TTAA 1 cut(s) 281
Tru9I TTAA 1 cut(s) 281
TspDTI ATGAA 5 cut(s) 180, 327, 378, 542, 641
XapI RAATTY 1 cut(s) 346
XceI RCATGY 1 cut(s) 226
XhoI CTCGAG 1 cut(s) 474
XmnI GAANNNNTTC 1 cut(s) 638
XspI CTAG 1 cut(s) 98
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.