pycom12420g00010

protein kinase activity

Design Primers CRISPR Design

Basic Information

Type: gene
Biological Identity
pyrus_communis
tig00012420
OG0000437
Physical Location & Seq
Reverse (-)
4629 .. 5003
375 bp
Loading structure...
UTR
Exon/CDS
Intron
pycom12420g00010.1

Sequence Viewer

Length: 375 bp
ATGCTCAGTATGACACCGGGTGAACGTGGACAACAACATATTGAAGATGAAGGCTTTTCCTTTTCTTTGTTGGAGAAGGCCAAGGATTGGTTGTATGAGTTAGCTCCCGGAACTATCACATCATGGGAGAGTATGAAGCGAGCCTTCTTGGAGAAGTTCTTTCCGACATCACGAGTCATTCTTCTTCATAAGAAGATTAGTGGAATTCAGCAAAGCCAAGGTGAATCTTTTCCAACTTATTATGAACGTTTTAAAACTCTTGTTGCTTCATGTCCACAGCACCAAATGAAGGAGGAGCTACTTCTTCAATATTTTTACGAAGGTCTTCTACCACTTGAACGGCAAATGTTGGATGCATCCACAGGAGGACTCTAG
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families
Asp_protease_2 RVT_1 Retrotrans_gag rve

Protein Analysis

125

Amino Acids

14.34

Weight (kDa)

5.61

Isoelectric Point (pI)

53.37

Instability Index
Protein Domains (Pfam)
Domain Name Pfam ID Position E-value Description
Retrotrans_gag PF03732 19 - 110 1.2e-20 Retrotransposon gag protein
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready
iTOL Interactive Tree Of Life · Most popular EvolView Flexible annotations MEGA Desktop phylogenetics suite FigTree Desktop tree editor

Orthologous Genes (Group: OG0000437)

Species Orthologous Gene IDs
arabidopsis_thaliana AT2G06105
fragaria_vesca FvH4_1g09709 FvH4_4g02101 FvH4_4g08975 FvH4_6g23372 FvH4_6g39851 FvH4_c1g00300
malus_domestica MD01G1176100.v1.1 MD09G1284900.v1.1 MD15G1306600.v1.1
prunus_persica Prupe.1G227700_v2.0.a1
pyrus_communis pycom01g00630 pycom01g01020 pycom01g01690 pycom01g01760 pycom01g04190 pycom01g04400 pycom02g18130 pycom03g10160 pycom05g06370 pycom05g08930 pycom06g05590 pycom10g06320 pycom11g14330 pycom11g15320 pycom11g16240 pycom12416g00050 pycom12420g00010 pycom12420g00120 pycom12426g00180 pycom12426g00710 pycom12531g00010 pycom1256g00020 pycom1256g00050 pycom1341g00030 pycom1353g00030 pycom13g23070 pycom13g23210 pycom13g26260 pycom13g26370 pycom13g26470 pycom13g26980 pycom14g08550 pycom14g08850 pycom1534g00040 pycom15g28760 pycom15g31230 pycom1604g00040 pycom16g21900 pycom16g26030 pycom1739g00020 pycom1739g00050 pycom17g12970 pycom17g17960 pycom17g18300 pycom17g18650 pycom2172g00020 pycom2438g00020 pycom436g00370 pycom436g00390 pycom576g00050 pycom76g00020
rosa_chinensis RchiOBHm_Chr1g0320811 RchiOBHm_Chr2g0135321 RchiOBHm_Chr3g0485721 RchiOBHm_Chr7g0236571
rosa_multiflora Rmu_sc0000185.1_g000007 Rmu_sc0002094.1_g000030 Rmu_sc0002764.1_g000007 Rmu_sc0002809.1_g000014 Rmu_sc0003005.1_g000007 Rmu_sc0003798.1_g000005 Rmu_sc0004646.1_g000027 Rmu_sc0004665.1_g000009 Rmu_sc0004818.1_g000001 Rmu_sc0004988.1_g000031 Rmu_sc0006373.1_g000007 Rmu_sc0007142.1_g000015 Rmu_sc0009930.1_g000001 Rmu_sc0011451.1_g000001 Rmu_sc0020424.1_g000001 Rmu_sc0036944.1_g000001 Rmu_ssc0000062.1_g000010
rosa_roxburghii Rroxscaffold_2G00123930 Rroxscaffold_3G00231480 Rroxscaffold_6G00413880
rosa_rugosa Rorug04G0084800
rosa_samantha Rh3BG150500 Rh6DG232400
rosa_wichuraiana Rw2G018400 Rw3G027860 Rw4G021220 Rw6G020670 Rw6G037970

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AccB7I CCANNNNNTGG 1 cut(s) 87
AclI AACGTT 1 cut(s) 247
AcsI RAATTY 1 cut(s) 204
AdeI CACNNNGTG 1 cut(s) 20
AfiI CCNNNNNNNGG 2 cut(s) 87, 289
AgsI TTSAA 3 cut(s) 44, 308, 338
AluBI AGCT 2 cut(s) 104, 298
AluI AGCT 2 cut(s) 104, 298
AoxI GGCC 1 cut(s) 78
ApoI RAATTY 1 cut(s) 204
Asp700I GAANNNNTTC 2 cut(s) 228, 324
AsuC2I CCSGG 2 cut(s) 18, 108
AsuHPI GGTGA 2 cut(s) 32, 233
BarI GAAGNNNNNNTAC 2 cut(s) 312, 344
BauI CACGAG 1 cut(s) 171
BbsI GAAGAC 1 cut(s) 317
BceAI ACGGC 1 cut(s) 356
BcnI CCSGG 2 cut(s) 18, 108
BfaI CTAG 1 cut(s) 373
Bme1390I CCNGG 2 cut(s) 18, 108
BmrFI CCNGG 2 cut(s) 18, 108
BmsI GCATC 2 cut(s) 343, 365
BpiI GAAGAC 1 cut(s) 317
BpuMI CCSGG 2 cut(s) 18, 108
BsaJI CCNNGG 2 cut(s) 81, 217
Bsc4I CCNNNNNNNGG 2 cut(s) 87, 289
BseDI CCNNGG 2 cut(s) 81, 217
BseGI GGATG 2 cut(s) 356, 358
BseLI CCNNNNNNNGG 2 cut(s) 87, 289
BseMII CTCAG 1 cut(s) 19
BseRI GAGGAG 1 cut(s) 308
BshFI GGCC 1 cut(s) 80
BsiSI CCGG 2 cut(s) 17, 108
BslI CCNNNNNNNGG 2 cut(s) 87, 289
BsnI GGCC 1 cut(s) 80
BspANI GGCC 1 cut(s) 80
BspCNI CTCAG 1 cut(s) 18
BssECI CCNNGG 2 cut(s) 81, 217
BssSI CACGAG 1 cut(s) 171
BssT1I CCWWGG 2 cut(s) 81, 217
Bst2BI CACGAG 1 cut(s) 171
BstC8I GCNNGC 1 cut(s) 141
BstDEI CTNAG 1 cut(s) 5
BstF5I GGATG 2 cut(s) 356, 358
BstSCI CCNGG 2 cut(s) 16, 106
BstV2I GAAGAC 1 cut(s) 317
BsuRI GGCC 1 cut(s) 80
BtsCI GGATG 2 cut(s) 356, 358
Cac8I GCNNGC 1 cut(s) 141
CviAII CATG 2 cut(s) 123, 270
CviJI RGCY 6 cut(s) 54, 80, 104, 143, 216, 298
CviKI_1 RGCY 6 cut(s) 54, 80, 104, 143, 216, 298
DdeI CTNAG 1 cut(s) 5
DraI TTTAAA 1 cut(s) 253
DraIII CACNNNGTG 1 cut(s) 20
Eco130I CCWWGG 2 cut(s) 81, 217
EcoRI GAATTC 1 cut(s) 204
EcoT14I CCWWGG 2 cut(s) 81, 217
EcoT22I ATGCAT 1 cut(s) 358
ErhI CCWWGG 2 cut(s) 81, 217
FaeI CATG 2 cut(s) 126, 273
FaiI YATR 8 cut(s) 11, 39, 96, 124, 134, 189, 243, 271
FalI AAGNNNNNCTT 2 cut(s) 128, 160
FatI CATG 2 cut(s) 122, 269
FokI GGATG 2 cut(s) 343, 365
FspBI CTAG 1 cut(s) 373
HaeIII GGCC 1 cut(s) 80
HapII CCGG 2 cut(s) 17, 108
Hin1II CATG 2 cut(s) 126, 273
HinfI GANTC 3 cut(s) 174, 224, 369
HpaII CCGG 2 cut(s) 17, 108
HphI GGTGA 2 cut(s) 32, 233
Hpy166II GTNNAC 3 cut(s) 23, 29, 275
Hpy188I TCNGA 1 cut(s) 165
Hpy188III TCNNGA 1 cut(s) 171
Hpy8I GTNNAC 3 cut(s) 23, 29, 275
HpyAV CCTTC 5 cut(s) 44, 70, 154, 283, 314
HpyCH4IV ACGT 2 cut(s) 25, 247
HpyCH4V TGCA 1 cut(s) 356
HpyF3I CTNAG 1 cut(s) 5
HpySE526I ACGT 2 cut(s) 25, 247
Hsp92II CATG 2 cut(s) 126, 273
LmnI GCTCC 2 cut(s) 109, 295
LpnPI CCDG 3 cut(s) 30, 121, 348
LweI GCATC 2 cut(s) 343, 365
MaeI CTAG 1 cut(s) 373
MaeII ACGT 2 cut(s) 25, 247
MboII GAAGA 6 cut(s) 56, 173, 176, 205, 296, 317
MluCI AATT 1 cut(s) 204
MlyI GAGTC 2 cut(s) 183, 363
MmeI TCCRAC 4 cut(s) 51, 188, 257, 330
MnlI CCTC 2 cut(s) 286, 359
Mph1103I ATGCAT 1 cut(s) 358
MroXI GAANNNNTTC 2 cut(s) 228, 324
MseI TTAA 1 cut(s) 252
MspI CCGG 2 cut(s) 17, 108
MspR9I CCNGG 2 cut(s) 18, 108
NciI CCSGG 2 cut(s) 18, 108
NlaIII CATG 2 cut(s) 126, 273
NsiI ATGCAT 1 cut(s) 358
PdmI GAANNNNTTC 2 cut(s) 228, 324
PfeI GAWTC 1 cut(s) 224
PflMI CCANNNNNTGG 1 cut(s) 87
PfoI TCCNGGA 1 cut(s) 106
PleI GAGTC 2 cut(s) 182, 363
PpsI GAGTC 2 cut(s) 182, 363
Psp1406I AACGTT 1 cut(s) 247
SaqAI TTAA 1 cut(s) 252
SchI GAGTC 2 cut(s) 183, 363
ScrFI CCNGG 2 cut(s) 18, 108
SetI ASST 6 cut(s) 28, 106, 223, 250, 300, 325
SfaNI GCATC 2 cut(s) 343, 365
Sse9I AATT 1 cut(s) 204
SspI AATATT 1 cut(s) 311
SspMI CTAG 1 cut(s) 373
StyD4I CCNGG 2 cut(s) 16, 106
StyI CCWWGG 2 cut(s) 81, 217
TaiI ACGT 2 cut(s) 28, 250
TasI AATT 1 cut(s) 204
TfiI GAWTC 1 cut(s) 224
Tru1I TTAA 1 cut(s) 252
Tru9I TTAA 1 cut(s) 252
TspDTI ATGAA 6 cut(s) 63, 149, 176, 258, 258, 302
Van91I CCANNNNNTGG 1 cut(s) 87
XapI RAATTY 1 cut(s) 204
XmnI GAANNNNTTC 2 cut(s) 228, 324
XspI CTAG 1 cut(s) 373
Zsp2I ATGCAT 1 cut(s) 358
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.