Rmu_sc0003005.1_g000007

transposition, RNA-mediated

Basic Information

Type: gene
Biological Identity
rosa_multiflora
Rmu_sc0003005.1
Physical Location & Seq
Forward (+)
31985 .. 32482
498 bp
Loading structure...
UTR
Exon/CDS
Intron
Rmu_sc0003005.1_g000007.1.cds

Sequence Viewer

Length: 369 bp
atgcttactcggaaaacttcacaaggcaaactcattcctttggattctgagatagaacgcaccttgcacggagacgaagaggaacagttcgaggaaccccccaaagttgagatggctggagcaagaccactgaaggatgccttcgtcccaacaacttttgaatctccttcatgcattgattatacaccggacggaaatcatgcctattccattgttgtgcagttgattaactcgttgcccaaatatatgggatccccatctgaggaccctaattttcatattagagagttcttggacatatgcaaattgcagactattcagtatgtgcccctgaaggcctcaggttacttctcttcccattttcgttaa
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families

Protein Analysis

122

Amino Acids

13.86

Weight (kDa)

5.12

Isoelectric Point (pI)

57.47

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Orthologous Genes (Group: OG0000437)

Species Orthologous Gene IDs
arabidopsis_thaliana AT2G06105
fragaria_vesca FvH4_1g09709 FvH4_4g02101 FvH4_4g08975 FvH4_6g23372 FvH4_6g39851 FvH4_c1g00300
malus_domestica MD01G1176100.v1.1 MD09G1284900.v1.1 MD15G1306600.v1.1
prunus_persica Prupe.1G227700_v2.0.a1
pyrus_communis pycom01g00630 pycom01g01020 pycom01g01690 pycom01g01760 pycom01g04190 pycom01g04400 pycom02g18130 pycom03g10160 pycom05g06370 pycom05g08930 pycom06g05590 pycom10g06320 pycom11g14330 pycom11g15320 pycom11g16240 pycom12416g00050 pycom12420g00010 pycom12420g00120 pycom12426g00180 pycom12426g00710 pycom12531g00010 pycom1256g00020 pycom1256g00050 pycom1341g00030 pycom1353g00030 pycom13g23070 pycom13g23210 pycom13g26260 pycom13g26370 pycom13g26470 pycom13g26980 pycom14g08550 pycom14g08850 pycom1534g00040 pycom15g28760 pycom15g31230 pycom1604g00040 pycom16g21900 pycom16g26030 pycom1739g00020 pycom1739g00050 pycom17g12970 pycom17g17960 pycom17g18300 pycom17g18650 pycom2172g00020 pycom2438g00020 pycom436g00370 pycom436g00390 pycom576g00050 pycom76g00020
rosa_chinensis RchiOBHm_Chr1g0320811 RchiOBHm_Chr2g0135321 RchiOBHm_Chr3g0485721 RchiOBHm_Chr7g0236571
rosa_multiflora Rmu_sc0000185.1_g000007 Rmu_sc0002094.1_g000030 Rmu_sc0002764.1_g000007 Rmu_sc0002809.1_g000014 Rmu_sc0003005.1_g000007 Rmu_sc0003798.1_g000005 Rmu_sc0004646.1_g000027 Rmu_sc0004665.1_g000009 Rmu_sc0004818.1_g000001 Rmu_sc0004988.1_g000031 Rmu_sc0006373.1_g000007 Rmu_sc0007142.1_g000015 Rmu_sc0009930.1_g000001 Rmu_sc0011451.1_g000001 Rmu_sc0020424.1_g000001 Rmu_sc0036944.1_g000001 Rmu_ssc0000062.1_g000010
rosa_roxburghii Rroxscaffold_2G00123930 Rroxscaffold_3G00231480 Rroxscaffold_6G00413880
rosa_rugosa Rorug04G0084800
rosa_samantha Rh3BG150500 Rh6DG232400
rosa_wichuraiana Rw2G018400 Rw3G027860 Rw4G021220 Rw6G020670 Rw6G037970

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AclWI GGATC 2 cut(s) 246, 259
AcuI CTGAAG 2 cut(s) 152, 353
AfiI CCNNNNNNNGG 1 cut(s) 262
AgsI TTSAA 1 cut(s) 161
Alw26I GTCTC 1 cut(s) 66
AlwI GGATC 2 cut(s) 246, 259
AoxI GGCC 1 cut(s) 336
AspS9I GGNCC 1 cut(s) 265
AvaII GGWCC 1 cut(s) 265
AxyI CCTNAGG 1 cut(s) 340
BaeGI GKGCMC 1 cut(s) 330
BamHI GGATCC 1 cut(s) 251
BccI CCATC 2 cut(s) 106, 265
BcoDI GTCTC 1 cut(s) 66
Bme18I GGWCC 1 cut(s) 265
BmgT120I GGNCC 1 cut(s) 265
BmiI GGNNCC 3 cut(s) 96, 253, 267
BmsI GCATC 1 cut(s) 127
BpmI CTGGAG 1 cut(s) 138
BsaBI GATNNNNATC 1 cut(s) 256
BsaWI WCCGGW 1 cut(s) 187
Bsc4I CCNNNNNNNGG 1 cut(s) 262
Bse21I CCTNAGG 1 cut(s) 340
Bse8I GATNNNNATC 1 cut(s) 256
BseGI GGATG 1 cut(s) 142
BseJI GATNNNNATC 1 cut(s) 256
BseLI CCNNNNNNNGG 1 cut(s) 262
BseMII CTCAG 3 cut(s) 39, 252, 354
BseSI GKGCMC 1 cut(s) 330
BsgI GTGCAG 1 cut(s) 239
BshFI GGCC 1 cut(s) 338
BsiSI CCGG 1 cut(s) 188
BslFI GGGAC 1 cut(s) 131
BslI CCNNNNNNNGG 1 cut(s) 262
BsmAI GTCTC 1 cut(s) 66
BsmBI CGTCTC 1 cut(s) 66
BsmFI GGGAC 1 cut(s) 131
BsnI GGCC 1 cut(s) 338
Bsp1286I GDGCHC 1 cut(s) 330
Bsp143I GATC 1 cut(s) 251
BspANI GGCC 1 cut(s) 338
BspCNI CTCAG 3 cut(s) 40, 253, 353
BspLI GGNNCC 3 cut(s) 96, 253, 267
BspPI GGATC 2 cut(s) 246, 259
BssMI GATC 1 cut(s) 251
Bst4CI ACNGT 1 cut(s) 87
Bst6I CTCTTC 2 cut(s) 72, 358
BstDEI CTNAG 3 cut(s) 48, 261, 340
BstF5I GGATG 1 cut(s) 142
BstKTI GATC 1 cut(s) 254
BstMAI GTCTC 1 cut(s) 66
BstMBI GATC 1 cut(s) 251
BstSLI GKGCMC 1 cut(s) 330
BstX2I RGATCY 1 cut(s) 251
BstXI CCANNNNNNTGG 1 cut(s) 247
BstYI RGATCY 1 cut(s) 251
Bsu36I CCTNAGG 1 cut(s) 340
BsuRI GGCC 1 cut(s) 338
BtsCI GGATG 1 cut(s) 142
BtsIMutI CAGTG 1 cut(s) 128
Cfr13I GGNCC 1 cut(s) 265
CviAII CATG 2 cut(s) 171, 200
CviJI RGCY 2 cut(s) 116, 338
CviKI_1 RGCY 2 cut(s) 116, 338
DdeI CTNAG 3 cut(s) 48, 261, 340
DpnI GATC 1 cut(s) 253
DpnII GATC 1 cut(s) 251
Eam1104I CTCTTC 2 cut(s) 72, 358
EarI CTCTTC 2 cut(s) 72, 358
Eco147I AGGCCT 1 cut(s) 338
Eco47I GGWCC 1 cut(s) 265
Eco57I CTGAAG 2 cut(s) 152, 353
Eco81I CCTNAGG 1 cut(s) 340
EcoO109I RGGNCCY 1 cut(s) 265
EcoT22I ATGCAT 1 cut(s) 176
Esp3I CGTCTC 1 cut(s) 66
FaeI CATG 2 cut(s) 174, 203
FaiI YATR 9 cut(s) 172, 183, 201, 246, 248, 279, 299, 301, 324
FalI AAGNNNNNCTT 2 cut(s) 125, 157
FaqI GGGAC 1 cut(s) 131
FatI CATG 2 cut(s) 170, 199
FauNDI CATATG 1 cut(s) 299
FokI GGATG 1 cut(s) 149
GsuI CTGGAG 1 cut(s) 138
HaeIII GGCC 1 cut(s) 338
HapII CCGG 1 cut(s) 188
Hin1II CATG 2 cut(s) 174, 203
HinfI GANTC 2 cut(s) 44, 161
HpaII CCGG 1 cut(s) 188
Hpy188I TCNGA 3 cut(s) 12, 49, 262
HpyAV CCTTC 4 cut(s) 127, 151, 177, 328
HpyCH4III ACNGT 1 cut(s) 87
HpyCH4V TGCA 5 cut(s) 67, 174, 220, 303, 310
HpyF3I CTNAG 3 cut(s) 48, 261, 340
Hsp92II CATG 2 cut(s) 174, 203
Kzo9I GATC 1 cut(s) 251
LmnI GCTCC 1 cut(s) 119
LpnPI CCDG 4 cut(s) 102, 201, 327, 344
LweI GCATC 1 cut(s) 127
MaeIII GTNAC 1 cut(s) 344
MalI GATC 1 cut(s) 253
MboI GATC 1 cut(s) 251
MboII GAAGA 2 cut(s) 89, 345
MflI RGATCY 1 cut(s) 251
MhlI GDGCHC 1 cut(s) 330
MluCI AATT 2 cut(s) 271, 305
MnlI CCTC 4 cut(s) 73, 85, 256, 349
Mph1103I ATGCAT 1 cut(s) 176
MseI TTAA 2 cut(s) 228, 367
MslI CAYNNNNRTG 1 cut(s) 215
MspI CCGG 1 cut(s) 188
NdeI CATATG 1 cut(s) 299
NdeII GATC 1 cut(s) 251
NlaIII CATG 2 cut(s) 174, 203
NlaIV GGNNCC 3 cut(s) 96, 253, 267
NsiI ATGCAT 1 cut(s) 176
PceI AGGCCT 1 cut(s) 338
PfeI GAWTC 2 cut(s) 44, 161
PpuMI RGGWCCY 1 cut(s) 265
Psp5II RGGWCCY 1 cut(s) 265
PspN4I GGNNCC 3 cut(s) 96, 253, 267
PspPI GGNCC 1 cut(s) 265
PspPPI RGGWCCY 1 cut(s) 265
PsuI RGATCY 1 cut(s) 251
RseI CAYNNNNRTG 1 cut(s) 215
SaqAI TTAA 2 cut(s) 228, 367
Sau3AI GATC 1 cut(s) 251
Sau96I GGNCC 1 cut(s) 265
SduI GDGCHC 1 cut(s) 330
SetI ASST 2 cut(s) 65, 346
SfaNI GCATC 1 cut(s) 127
SinI GGWCC 1 cut(s) 265
SmiMI CAYNNNNRTG 1 cut(s) 215
Sse9I AATT 2 cut(s) 271, 305
SseBI AGGCCT 1 cut(s) 338
StuI AGGCCT 1 cut(s) 338
TaaI ACNGT 1 cut(s) 87
TaqI TCGA 1 cut(s) 90
TasI AATT 2 cut(s) 271, 305
TfiI GAWTC 2 cut(s) 44, 161
Tru1I TTAA 2 cut(s) 228, 367
Tru9I TTAA 2 cut(s) 228, 367
TscAI CASTG 1 cut(s) 135
TspDTI ATGAA 2 cut(s) 159, 266
TspGWI ACGGA 2 cut(s) 84, 207
TspRI CASTG 1 cut(s) 135
VpaK11BI GGWCC 1 cut(s) 265
XcmI CCANNNNNNNNNTGG 1 cut(s) 109
Zsp2I ATGCAT 1 cut(s) 176
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.