Rh6DG232400

No description available

Design Primers CRISPR Design

Basic Information

Type: gene
Biological Identity
rosa_samantha
Chr6D
OG0000437
Physical Location & Seq
Forward (+)
41407414 .. 41439403
31990 bp
Loading structure...
UTR
Exon/CDS
Intron
Rh6DG232400.1

Sequence Viewer

Length: 261 bp
ATGAGGTACTTCAACTCGTTTATGCATACAAGGAAAAATCCAAAAGGCGAGCTTGTTCCTTTTGATCCTGAACTTCTGAAAACAATTCGAATCAATAAAAAGCTTAAGGAAGCAAGCTCGTCTTCACCAAAGGAAGAAGGAGAGACACTGATTGTCATTGTGATGAACGGAGTTCATGACCTCGTAAAGGAGAAATATGTTCCTGCTGGATTCAGTCATGACACTTCACCAATAATCATAGAGTTTTATAATTTTCACTAA
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families
No domains found.

Protein Analysis

86

Amino Acids

9.94

Weight (kDa)

8.02

Isoelectric Point (pI)

45.12

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready
iTOL Interactive Tree Of Life · Most popular EvolView Flexible annotations MEGA Desktop phylogenetics suite FigTree Desktop tree editor

Orthologous Genes (Group: OG0000437)

Species Orthologous Gene IDs
arabidopsis_thaliana AT2G06105
fragaria_vesca FvH4_1g09709 FvH4_4g02101 FvH4_4g08975 FvH4_6g23372 FvH4_6g39851 FvH4_c1g00300
malus_domestica MD01G1176100.v1.1 MD09G1284900.v1.1 MD15G1306600.v1.1
prunus_persica Prupe.1G227700_v2.0.a1
pyrus_communis pycom01g00630 pycom01g01020 pycom01g01690 pycom01g01760 pycom01g04190 pycom01g04400 pycom02g18130 pycom03g10160 pycom05g06370 pycom05g08930 pycom06g05590 pycom10g06320 pycom11g14330 pycom11g15320 pycom11g16240 pycom12416g00050 pycom12420g00010 pycom12420g00120 pycom12426g00180 pycom12426g00710 pycom12531g00010 pycom1256g00020 pycom1256g00050 pycom1341g00030 pycom1353g00030 pycom13g23070 pycom13g23210 pycom13g26260 pycom13g26370 pycom13g26470 pycom13g26980 pycom14g08550 pycom14g08850 pycom1534g00040 pycom15g28760 pycom15g31230 pycom1604g00040 pycom16g21900 pycom16g26030 pycom1739g00020 pycom1739g00050 pycom17g12970 pycom17g17960 pycom17g18300 pycom17g18650 pycom2172g00020 pycom2438g00020 pycom436g00370 pycom436g00390 pycom576g00050 pycom76g00020
rosa_chinensis RchiOBHm_Chr1g0320811 RchiOBHm_Chr2g0135321 RchiOBHm_Chr3g0485721 RchiOBHm_Chr7g0236571
rosa_multiflora Rmu_sc0000185.1_g000007 Rmu_sc0002094.1_g000030 Rmu_sc0002764.1_g000007 Rmu_sc0002809.1_g000014 Rmu_sc0003005.1_g000007 Rmu_sc0003798.1_g000005 Rmu_sc0004646.1_g000027 Rmu_sc0004665.1_g000009 Rmu_sc0004818.1_g000001 Rmu_sc0004988.1_g000031 Rmu_sc0006373.1_g000007 Rmu_sc0007142.1_g000015 Rmu_sc0009930.1_g000001 Rmu_sc0011451.1_g000001 Rmu_sc0020424.1_g000001 Rmu_sc0036944.1_g000001 Rmu_ssc0000062.1_g000010
rosa_roxburghii Rroxscaffold_2G00123930 Rroxscaffold_3G00231480 Rroxscaffold_6G00413880
rosa_rugosa Rorug04G0084800
rosa_samantha Rh3BG150500 Rh6DG232400
rosa_wichuraiana Rw2G018400 Rw3G027860 Rw4G021220 Rw6G020670 Rw6G037970

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AanI TTATAA 1 cut(s) 249
AclWI GGATC 1 cut(s) 59
AfaI GTAC 1 cut(s) 8
AfiI CCNNNNNNNGG 1 cut(s) 187
AflII CTTAAG 1 cut(s) 104
AgsI TTSAA 1 cut(s) 13
AluBI AGCT 3 cut(s) 52, 103, 117
AluI AGCT 3 cut(s) 52, 103, 117
Alw26I GTCTC 1 cut(s) 137
AlwI GGATC 1 cut(s) 59
AsuHPI GGTGA 2 cut(s) 117, 219
AsuII TTCGAA 1 cut(s) 88
BbsI GAAGAC 1 cut(s) 114
BcoDI GTCTC 1 cut(s) 137
BfrI CTTAAG 1 cut(s) 104
BpiI GAAGAC 1 cut(s) 114
Bpu14I TTCGAA 1 cut(s) 88
Bsc4I CCNNNNNNNGG 1 cut(s) 187
BseLI CCNNNNNNNGG 1 cut(s) 187
BslI CCNNNNNNNGG 1 cut(s) 187
BsmAI GTCTC 1 cut(s) 137
Bsp119I TTCGAA 1 cut(s) 88
Bsp143I GATC 1 cut(s) 64
BspHI TCATGA 2 cut(s) 175, 217
BspPI GGATC 1 cut(s) 59
BspT104I TTCGAA 1 cut(s) 88
BspTI CTTAAG 1 cut(s) 104
BssMI GATC 1 cut(s) 64
BstAFI CTTAAG 1 cut(s) 104
BstBI TTCGAA 1 cut(s) 88
BstC8I GCNNGC 2 cut(s) 50, 115
BstENI CCTNNNNNAGG 1 cut(s) 185
BstKTI GATC 1 cut(s) 67
BstMAI GTCTC 1 cut(s) 137
BstMBI GATC 1 cut(s) 64
BstV2I GAAGAC 1 cut(s) 114
BtsIMutI CAGTG 1 cut(s) 146
Cac8I GCNNGC 2 cut(s) 50, 115
CciI TCATGA 2 cut(s) 175, 217
Csp6I GTAC 1 cut(s) 7
CviAII CATG 2 cut(s) 176, 218
CviJI RGCY 3 cut(s) 52, 103, 117
CviKI_1 RGCY 3 cut(s) 52, 103, 117
CviQI GTAC 1 cut(s) 7
DpnI GATC 1 cut(s) 66
DpnII GATC 1 cut(s) 64
EcoNI CCTNNNNNAGG 1 cut(s) 185
EcoT22I ATGCAT 1 cut(s) 27
FaeI CATG 2 cut(s) 179, 221
FaiI YATR 7 cut(s) 23, 27, 177, 198, 219, 239, 249
FalI AAGNNNNNCTT 4 cut(s) 36, 68, 106, 138
FatI CATG 2 cut(s) 175, 217
Hin1II CATG 2 cut(s) 179, 221
HindIII AAGCTT 1 cut(s) 101
HinfI GANTC 2 cut(s) 90, 210
HphI GGTGA 2 cut(s) 117, 219
Hpy188I TCNGA 1 cut(s) 78
Hpy188III TCNNGA 3 cut(s) 68, 176, 218
HpyAV CCTTC 1 cut(s) 131
HpyCH4V TGCA 1 cut(s) 25
Hsp92II CATG 2 cut(s) 179, 221
Kzo9I GATC 1 cut(s) 64
LpnPI CCDG 3 cut(s) 81, 192, 216
MalI GATC 1 cut(s) 66
MboI GATC 1 cut(s) 64
MboII GAAGA 2 cut(s) 114, 146
MluCI AATT 2 cut(s) 84, 250
MnlI CCTC 1 cut(s) 191
Mph1103I ATGCAT 1 cut(s) 27
MseI TTAA 1 cut(s) 105
MslI CAYNNNNRTG 1 cut(s) 161
MspCI CTTAAG 1 cut(s) 104
NdeII GATC 1 cut(s) 64
NlaIII CATG 2 cut(s) 179, 221
NsiI ATGCAT 1 cut(s) 27
NspV TTCGAA 1 cut(s) 88
PagI TCATGA 2 cut(s) 175, 217
PfeI GAWTC 2 cut(s) 90, 210
PsiI TTATAA 1 cut(s) 249
RsaI GTAC 1 cut(s) 8
RsaNI GTAC 1 cut(s) 7
RseI CAYNNNNRTG 1 cut(s) 161
SaqAI TTAA 1 cut(s) 105
Sau3AI GATC 1 cut(s) 64
SetI ASST 5 cut(s) 8, 54, 105, 119, 183
SfuI TTCGAA 1 cut(s) 88
SmiMI CAYNNNNRTG 1 cut(s) 161
SmlI CTYRAG 1 cut(s) 104
SmoI CTYRAG 1 cut(s) 104
Sse9I AATT 2 cut(s) 84, 250
TaqI TCGA 1 cut(s) 88
TasI AATT 2 cut(s) 84, 250
TfiI GAWTC 2 cut(s) 90, 210
Tru1I TTAA 1 cut(s) 105
Tru9I TTAA 1 cut(s) 105
TscAI CASTG 1 cut(s) 153
TspDTI ATGAA 2 cut(s) 164, 179
TspGWI ACGGA 1 cut(s) 183
TspRI CASTG 1 cut(s) 153
Vha464I CTTAAG 1 cut(s) 104
XagI CCTNNNNNAGG 1 cut(s) 185
Zsp2I ATGCAT 1 cut(s) 27
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.