pycom16g26030

transposition, RNA-mediated

Basic Information

Type: gene
Biological Identity
pyrus_communis
Chr16
Physical Location & Seq
Reverse (-)
28264145 .. 28268421
4277 bp
Loading structure...
UTR
Exon/CDS
Intron
pycom16g26030.2

Sequence Viewer

Length: 846 bp
ATGGCCATGGACAATCGAACCATCAAAGAGCTTTCTGCCTCGGGTTTGGCCAATGCAGCCCCTCTTTACATTCAATACCCCGAGGCTGCCCAAGGCAAGATTGATGAATTCGAGTTGAAGTCAAGCTTATTGCACCACATTCCGAAATACCATGGGCTTTCCATGGAAGATCCCAACAAGCATCTCAAGGAGTTCGAGGTTGTTTGTTCGAGCATGACACCCATAAATGTTGATGGGAACATTCTGATGATAAAGGCTTTTCCATTCTCTCTTGTAGAAAAGGCTAAGGATTGGCTTTATGAATTGGCACCCGGGACCGTTACTTCTTGGGAGAGCATGAAGAGAGCGTTCTTGGAGAAGTTCTTCCCTACTTCAAAAGTCATTCTCTTAAGGAAGAAAATTAGCGGAATCCAACAAAGTCAAGGAGAATCTTTTCCGCACTTAAAAGAAGCTCTCACTTCGGCTCCCATTATCACACCTCCAGATTGGAGCCTTCCATTCGAGCTGATGTGCGATGCTTCGGACTATGCGATTGGTGCTGTTTTGGGGCAGCGAAAGAACAAACAACCTCATGTTATTTATTATGCATCTAGGACACTAAATGATGCTCAATTGAATTACTCAACCACTGAAAAAGAATTACTTGTTGTGGTATTTGCATTAGATAAGTTCCGATCCTACTTACTTGGTACTAAAGTTATTATTTTTACGGATCATGCAGCTCTCAAGTATTTGCTCACGAAAAAGGAGGCCAAGCCTAGACTAATTCGTTGGATATTGCTTCTACAAGAGTTTGACATTGAGATTCGAGATAAGAAGGTTTGGCACCCAACGCACTGCCCTTAA
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families

Protein Analysis

282

Amino Acids

32.05

Weight (kDa)

8.56

Isoelectric Point (pI)

40.78

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Orthologous Genes (Group: OG0000437)

Species Orthologous Gene IDs
arabidopsis_thaliana AT2G06105
fragaria_vesca FvH4_1g09709 FvH4_4g02101 FvH4_4g08975 FvH4_6g23372 FvH4_6g39851 FvH4_c1g00300
malus_domestica MD01G1176100.v1.1 MD09G1284900.v1.1 MD15G1306600.v1.1
prunus_persica Prupe.1G227700_v2.0.a1
pyrus_communis pycom01g00630 pycom01g01020 pycom01g01690 pycom01g01760 pycom01g04190 pycom01g04400 pycom02g18130 pycom03g10160 pycom05g06370 pycom05g08930 pycom06g05590 pycom10g06320 pycom11g14330 pycom11g15320 pycom11g16240 pycom12416g00050 pycom12420g00010 pycom12420g00120 pycom12426g00180 pycom12426g00710 pycom12531g00010 pycom1256g00020 pycom1256g00050 pycom1341g00030 pycom1353g00030 pycom13g23070 pycom13g23210 pycom13g26260 pycom13g26370 pycom13g26470 pycom13g26980 pycom14g08550 pycom14g08850 pycom1534g00040 pycom15g28760 pycom15g31230 pycom1604g00040 pycom16g21900 pycom16g26030 pycom1739g00020 pycom1739g00050 pycom17g12970 pycom17g17960 pycom17g18300 pycom17g18650 pycom2172g00020 pycom2438g00020 pycom436g00370 pycom436g00390 pycom576g00050 pycom76g00020
rosa_chinensis RchiOBHm_Chr1g0320811 RchiOBHm_Chr2g0135321 RchiOBHm_Chr3g0485721 RchiOBHm_Chr7g0236571
rosa_multiflora Rmu_sc0000185.1_g000007 Rmu_sc0002094.1_g000030 Rmu_sc0002764.1_g000007 Rmu_sc0002809.1_g000014 Rmu_sc0003005.1_g000007 Rmu_sc0003798.1_g000005 Rmu_sc0004646.1_g000027 Rmu_sc0004665.1_g000009 Rmu_sc0004818.1_g000001 Rmu_sc0004988.1_g000031 Rmu_sc0006373.1_g000007 Rmu_sc0007142.1_g000015 Rmu_sc0009930.1_g000001 Rmu_sc0011451.1_g000001 Rmu_sc0020424.1_g000001 Rmu_sc0036944.1_g000001 Rmu_ssc0000062.1_g000010
rosa_roxburghii Rroxscaffold_2G00123930 Rroxscaffold_3G00231480 Rroxscaffold_6G00413880
rosa_rugosa Rorug04G0084800
rosa_samantha Rh3BG150500 Rh6DG232400
rosa_wichuraiana Rw2G018400 Rw3G027860 Rw4G021220 Rw6G020670 Rw6G037970

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AccB1I GGYRCC 2 cut(s) 307, 825
AciI CCGC 2 cut(s) 405, 437
AclWI GGATC 3 cut(s) 164, 669, 720
AcoI YGGCCR 2 cut(s) 3, 48
AcsI RAATTY 1 cut(s) 107
AfaI GTAC 1 cut(s) 691
AflII CTTAAG 1 cut(s) 388
AgsI TTSAA 4 cut(s) 74, 118, 375, 616
AluBI AGCT 5 cut(s) 31, 126, 452, 505, 722
AluI AGCT 5 cut(s) 31, 126, 452, 505, 722
AlwI GGATC 3 cut(s) 164, 669, 720
Ama87I CYCGRG 3 cut(s) 40, 80, 311
AoxI GGCC 3 cut(s) 3, 48, 750
ApeKI GCWGC 4 cut(s) 56, 86, 550, 719
ApoI RAATTY 1 cut(s) 107
Asp700I GAANNNNTTC 2 cut(s) 362, 432
AspS9I GGNCC 1 cut(s) 315
AsuC2I CCSGG 2 cut(s) 312, 313
AvaI CYCGRG 3 cut(s) 40, 80, 311
AvaII GGWCC 1 cut(s) 315
BaeI ACNNNNGTAYC 2 cut(s) 681, 714
BalI TGGCCA 2 cut(s) 5, 50
BanI GGYRCC 2 cut(s) 307, 825
BbvI GCAGC 4 cut(s) 68, 73, 562, 731
BccI CCATC 2 cut(s) 29, 227
BcnI CCSGG 2 cut(s) 312, 313
BfaI CTAG 2 cut(s) 591, 759
BfrI CTTAAG 1 cut(s) 388
BisI GCNGC 4 cut(s) 57, 87, 551, 720
BlsI GCNGC 4 cut(s) 58, 88, 552, 721
Bme1390I CCNGG 2 cut(s) 312, 313
Bme18I GGWCC 1 cut(s) 315
BmeT110I CYCGRG 3 cut(s) 40, 80, 311
BmgT120I GGNCC 1 cut(s) 315
BmiI GGNNCC 5 cut(s) 309, 316, 465, 491, 827
BmrFI CCNGG 2 cut(s) 312, 313
BmsI GCATC 4 cut(s) 190, 505, 595, 596
BpmI CTGGAG 1 cut(s) 465
Bpu10I CCTNAGC 1 cut(s) 285
BpuEI CTTGAG 2 cut(s) 170, 710
BpuMI CCSGG 2 cut(s) 312, 313
BsaJI CCNNGG 7 cut(s) 6, 39, 81, 91, 151, 162, 311
BsaXI ACNNNNNCTCC 2 cut(s) 448, 478
BseDI CCNNGG 7 cut(s) 6, 39, 81, 91, 151, 162, 311
BseXI GCAGC 4 cut(s) 68, 73, 562, 731
BshFI GGCC 3 cut(s) 5, 50, 752
BshNI GGYRCC 2 cut(s) 307, 825
BsiHKCI CYCGRG 3 cut(s) 40, 80, 311
BsiSI CCGG 1 cut(s) 312
BslFI GGGAC 1 cut(s) 328
BsmFI GGGAC 1 cut(s) 328
BsnI GGCC 3 cut(s) 5, 50, 752
BsoBI CYCGRG 3 cut(s) 40, 80, 311
Bsp143I GATC 3 cut(s) 169, 674, 712
Bsp19I CCATGG 3 cut(s) 6, 151, 162
BspACI CCGC 2 cut(s) 405, 437
BspANI GGCC 3 cut(s) 5, 50, 752
BspLI GGNNCC 5 cut(s) 309, 316, 465, 491, 827
BspPI GGATC 3 cut(s) 164, 669, 720
BspT107I GGYRCC 2 cut(s) 307, 825
BspTI CTTAAG 1 cut(s) 388
BssECI CCNNGG 7 cut(s) 6, 39, 81, 91, 151, 162, 311
BssMI GATC 3 cut(s) 169, 674, 712
BssT1I CCWWGG 4 cut(s) 6, 91, 151, 162
Bst4CI ACNGT 1 cut(s) 319
Bst6I CTCTTC 1 cut(s) 335
BstAFI CTTAAG 1 cut(s) 388
BstDEI CTNAG 1 cut(s) 285
BstDSI CCRYGG 3 cut(s) 6, 151, 162
BstKTI GATC 3 cut(s) 172, 677, 715
BstMBI GATC 3 cut(s) 169, 674, 712
BstMWI GCNNNNNNNGC 3 cut(s) 56, 536, 832
BstSCI CCNGG 2 cut(s) 310, 311
BstV1I GCAGC 4 cut(s) 68, 73, 562, 731
BstX2I RGATCY 1 cut(s) 169
BstYI RGATCY 1 cut(s) 169
BsuRI GGCC 3 cut(s) 5, 50, 752
BtgI CCRYGG 3 cut(s) 6, 151, 162
BtgZI GCGATG 1 cut(s) 528
BtsI GCAGTG 1 cut(s) 835
BtsIMutI CAGTG 2 cut(s) 627, 835
Cfr13I GGNCC 1 cut(s) 315
Cfr9I CCCGGG 1 cut(s) 311
Csp6I GTAC 1 cut(s) 690
CviAII CATG 7 cut(s) 7, 152, 163, 214, 337, 572, 716
CviQI GTAC 1 cut(s) 690
DdeI CTNAG 1 cut(s) 285
DpnI GATC 3 cut(s) 171, 676, 714
DpnII GATC 3 cut(s) 169, 674, 712
EaeI YGGCCR 2 cut(s) 3, 48
Eam1104I CTCTTC 1 cut(s) 335
EarI CTCTTC 1 cut(s) 335
Eco130I CCWWGG 4 cut(s) 6, 91, 151, 162
Eco47I GGWCC 1 cut(s) 315
Eco88I CYCGRG 3 cut(s) 40, 80, 311
EcoRI GAATTC 1 cut(s) 107
EcoT14I CCWWGG 4 cut(s) 6, 91, 151, 162
EcoT22I ATGCAT 1 cut(s) 589
ErhI CCWWGG 4 cut(s) 6, 91, 151, 162
FaeI CATG 7 cut(s) 10, 155, 166, 217, 340, 575, 719
FalI AAGNNNNNCTT 4 cut(s) 110, 142, 627, 659
FaqI GGGAC 1 cut(s) 328
FatI CATG 7 cut(s) 6, 151, 162, 213, 336, 571, 715
Fnu4HI GCNGC 4 cut(s) 57, 87, 551, 720
Fsp4HI GCNGC 4 cut(s) 57, 87, 551, 720
FspBI CTAG 2 cut(s) 591, 759
GluI GCNGC 4 cut(s) 57, 87, 551, 720
GsuI CTGGAG 1 cut(s) 465
HaeIII GGCC 3 cut(s) 5, 50, 752
HapII CCGG 1 cut(s) 312
Hin1II CATG 7 cut(s) 10, 155, 166, 217, 340, 575, 719
HindIII AAGCTT 1 cut(s) 124
HinfI GANTC 3 cut(s) 408, 428, 805
HpaII CCGG 1 cut(s) 312
Hpy188I TCNGA 4 cut(s) 144, 246, 523, 674
Hpy188III TCNNGA 3 cut(s) 482, 739, 809
HpyAV CCTTC 2 cut(s) 503, 811
HpyCH4III ACNGT 1 cut(s) 319
HpyCH4V TGCA 5 cut(s) 56, 133, 587, 659, 719
HpyF10VI GCNNNNNNNGC 3 cut(s) 56, 536, 832
HpyF3I CTNAG 1 cut(s) 285
Hsp92II CATG 7 cut(s) 10, 155, 166, 217, 340, 575, 719
Kzo9I GATC 3 cut(s) 169, 674, 712
LmnI GCTCC 2 cut(s) 469, 489
LpnPI CCDG 2 cut(s) 325, 495
Lsp1109I GCAGC 4 cut(s) 68, 73, 562, 731
LweI GCATC 4 cut(s) 190, 505, 595, 596
MaeI CTAG 2 cut(s) 591, 759
MaeIII GTNAC 1 cut(s) 319
MalI GATC 3 cut(s) 171, 676, 714
MboI GATC 3 cut(s) 169, 674, 712
MboII GAAGA 4 cut(s) 179, 352, 355, 406
MfeI CAATTG 1 cut(s) 611
MflI RGATCY 1 cut(s) 169
MlsI TGGCCA 2 cut(s) 5, 50
MluCI AATT 7 cut(s) 107, 302, 399, 611, 616, 638, 765
MluNI TGGCCA 2 cut(s) 5, 50
MmeI TCCRAC 2 cut(s) 436, 752
MnlI CCTC 7 cut(s) 49, 72, 76, 190, 489, 579, 742
Mox20I TGGCCA 2 cut(s) 5, 50
Mph1103I ATGCAT 1 cut(s) 589
MroXI GAANNNNTTC 2 cut(s) 362, 432
MscI TGGCCA 2 cut(s) 5, 50
MseI TTAA 3 cut(s) 389, 443, 844
MslI CAYNNNNRTG 1 cut(s) 245
Msp20I TGGCCA 2 cut(s) 5, 50
MspCI CTTAAG 1 cut(s) 388
MspI CCGG 1 cut(s) 312
MspR9I CCNGG 2 cut(s) 312, 313
MunI CAATTG 1 cut(s) 611
MwoI GCNNNNNNNGC 3 cut(s) 56, 536, 832
NciI CCSGG 2 cut(s) 312, 313
NcoI CCATGG 3 cut(s) 6, 151, 162
NdeII GATC 3 cut(s) 169, 674, 712
NlaIII CATG 7 cut(s) 10, 155, 166, 217, 340, 575, 719
NlaIV GGNNCC 5 cut(s) 309, 316, 465, 491, 827
NsiI ATGCAT 1 cut(s) 589
PcsI WCGNNNNNNNCGW 1 cut(s) 527
PdmI GAANNNNTTC 2 cut(s) 362, 432
PfeI GAWTC 3 cut(s) 408, 428, 805
PkrI GCNGC 4 cut(s) 58, 88, 552, 721
PspN4I GGNNCC 5 cut(s) 309, 316, 465, 491, 827
PspPI GGNCC 1 cut(s) 315
PsuI RGATCY 1 cut(s) 169
RsaI GTAC 1 cut(s) 691
RsaNI GTAC 1 cut(s) 690
RseI CAYNNNNRTG 1 cut(s) 245
SaqAI TTAA 3 cut(s) 389, 443, 844
SatI GCNGC 4 cut(s) 57, 87, 551, 720
Sau3AI GATC 3 cut(s) 169, 674, 712
Sau96I GGNCC 1 cut(s) 315
ScrFI CCNGG 2 cut(s) 312, 313
SetI ASST 9 cut(s) 33, 128, 201, 454, 481, 507, 571, 724, 822
SfaNI GCATC 4 cut(s) 190, 505, 595, 596
SinI GGWCC 1 cut(s) 315
SmaI CCCGGG 1 cut(s) 313
SmiMI CAYNNNNRTG 1 cut(s) 245
SmlI CTYRAG 3 cut(s) 185, 388, 725
SmoI CTYRAG 3 cut(s) 185, 388, 725
Sse9I AATT 7 cut(s) 107, 302, 399, 611, 616, 638, 765
SsiI CCGC 2 cut(s) 405, 437
SspMI CTAG 2 cut(s) 591, 759
StyD4I CCNGG 2 cut(s) 310, 311
StyI CCWWGG 4 cut(s) 6, 91, 151, 162
TaaI ACNGT 1 cut(s) 319
TaqI TCGA 6 cut(s) 16, 111, 195, 209, 501, 808
TasI AATT 7 cut(s) 107, 302, 399, 611, 616, 638, 765
TfiI GAWTC 3 cut(s) 408, 428, 805
Tru1I TTAA 3 cut(s) 389, 443, 844
Tru9I TTAA 3 cut(s) 389, 443, 844
TscAI CASTG 2 cut(s) 634, 842
TseI GCWGC 4 cut(s) 56, 86, 550, 719
TspDTI ATGAA 3 cut(s) 120, 315, 353
TspGWI ACGGA 1 cut(s) 725
TspMI CCCGGG 1 cut(s) 311
TspRI CASTG 2 cut(s) 634, 842
Vha464I CTTAAG 1 cut(s) 388
VpaK11BI GGWCC 1 cut(s) 315
XapI RAATTY 1 cut(s) 107
XmaI CCCGGG 1 cut(s) 311
XmnI GAANNNNTTC 2 cut(s) 362, 432
XspI CTAG 2 cut(s) 591, 759
Zsp2I ATGCAT 1 cut(s) 589
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.