MD07G1127200.v1.1

No description available

Basic Information

Type: gene
Biological Identity
malus_domestica
Chr07
Physical Location & Seq
Forward (+)
17966089 .. 17968736
2648 bp
Loading structure...
UTR
Exon/CDS
Intron
MD07G1127200.v1.1.491

Sequence Viewer

Length: 225 bp
ATGGAGCATAATGGATGGACATTTTTAAAGTTTAAAGAGGCTAGGAATGTGCTACAAATATGGAAGAATGAAATCAAGACTTGGAGGATAAGGAATCAGGTAAAAAGAGGGAACATTATCTTAACCAACCTTATCTTATCCAACATTATCCAAACTAACTTTATCTTATCTTATCCTATTCTAATCTTATCCTACCTGATTTCCAGCTGCAAGGAGAACATCTAA
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families
No domains found.

Protein Analysis

75

Amino Acids

8.85

Weight (kDa)

10.01

Isoelectric Point (pI)

48.4

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AluBI AGCT 1 cut(s) 207
AluI AGCT 1 cut(s) 207
ApeKI GCWGC 1 cut(s) 207
BbvI GCAGC 1 cut(s) 194
BccI CCATC 1 cut(s) 9
BfaI CTAG 1 cut(s) 42
BisI GCNGC 1 cut(s) 208
BlsI GCNGC 1 cut(s) 209
BseGI GGATG 1 cut(s) 20
BseXI GCAGC 1 cut(s) 194
BstF5I GGATG 1 cut(s) 20
BstV1I GCAGC 1 cut(s) 194
BtsCI GGATG 1 cut(s) 20
CviJI RGCY 2 cut(s) 41, 207
CviKI_1 RGCY 2 cut(s) 41, 207
DraI TTTAAA 2 cut(s) 27, 34
FaiI YATR 2 cut(s) 9, 61
Fnu4HI GCNGC 1 cut(s) 208
FokI GGATG 1 cut(s) 27
Fsp4HI GCNGC 1 cut(s) 208
FspBI CTAG 1 cut(s) 42
GluI GCNGC 1 cut(s) 208
HinfI GANTC 1 cut(s) 94
Hpy188III TCNNGA 1 cut(s) 76
HpyCH4V TGCA 1 cut(s) 210
LmnI GCTCC 1 cut(s) 4
LpnPI CCDG 3 cut(s) 83, 209, 217
Lsp1109I GCAGC 1 cut(s) 194
MaeI CTAG 1 cut(s) 42
MboII GAAGA 1 cut(s) 76
MmeI TCCRAC 1 cut(s) 165
MnlI CCTC 3 cut(s) 31, 78, 101
MseI TTAA 3 cut(s) 26, 33, 122
MspA1I CMGCKG 1 cut(s) 207
PfeI GAWTC 1 cut(s) 94
PkrI GCNGC 1 cut(s) 209
PvuII CAGCTG 1 cut(s) 207
SaqAI TTAA 3 cut(s) 26, 33, 122
SatI GCNGC 1 cut(s) 208
SetI ASST 4 cut(s) 102, 132, 198, 209
SgeI CNNG 6 cut(s) 54, 88, 93, 110, 208, 216
SspMI CTAG 1 cut(s) 42
TfiI GAWTC 1 cut(s) 94
Tru1I TTAA 3 cut(s) 26, 33, 122
Tru9I TTAA 3 cut(s) 26, 33, 122
TseI GCWGC 1 cut(s) 207
TspDTI ATGAA 1 cut(s) 84
XspI CTAG 1 cut(s) 42
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.