pycom13g24710

No description available

Basic Information

Type: gene
Biological Identity
pyrus_communis
Chr13
Physical Location & Seq
Forward (+)
21727580 .. 21728175
596 bp
Loading structure...
UTR
Exon/CDS
Intron
pycom13g24710.5

Sequence Viewer

Length: 402 bp
ATGGGTGAAAAGCTAGCTAGAGGATTCTTCTCCACACATGAAACATATGCACATAAATCGATTTCCATAATTGTGAATGCACAAATTAATTCTCAGACTTTCCTAAGTTCATTGAATTGGACTCAGCGACACAACCAAATTATCCTTCTCAAGTTCCCTAACTATGAAAAGCATGATAGAGACACATATCAAAGGTCATTAAGTTTTGTGAAAATCATAAGCATTGACAAAGCATTCGTAACTATGAAAATGACTTTTACTACTTATAAATATAAGTTCATAACGATTAGGTTAAATTCTCTTATATTCTACTATAAAGCAGATAATCATATAAAACATATGATCATGGCTTCGAATTCACCTCTAGCTAAAAAGAAATTTAGTTATGCATGTTCAAATTAA
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families
No domains found.

Protein Analysis

134

Amino Acids

15.66

Weight (kDa)

9.93

Isoelectric Point (pI)

33.42

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AanI TTATAA 1 cut(s) 267
AcsI RAATTY 3 cut(s) 295, 355, 377
AgsI TTSAA 2 cut(s) 115, 396
AjuI GAANNNNNNNTTGG 2 cut(s) 129, 161
AluBI AGCT 3 cut(s) 13, 17, 368
AluI AGCT 3 cut(s) 13, 17, 368
Alw26I GTCTC 1 cut(s) 174
ApoI RAATTY 3 cut(s) 295, 355, 377
ArsI GACNNNNNNTTYG 2 cut(s) 218, 250
AseI ATTAAT 1 cut(s) 87
AsuHPI GGTGA 2 cut(s) 17, 351
AsuII TTCGAA 1 cut(s) 353
AsuNHI GCTAGC 1 cut(s) 13
BcgI CGANNNNNNTGC 2 cut(s) 39, 73
BclI TGATCA 1 cut(s) 342
BcoDI GTCTC 1 cut(s) 174
BfaI CTAG 3 cut(s) 14, 18, 365
BmtI GCTAGC 1 cut(s) 17
Bpu14I TTCGAA 1 cut(s) 353
BpuEI CTTGAG 1 cut(s) 134
Bsa29I ATCGAT 1 cut(s) 59
BseCI ATCGAT 1 cut(s) 59
BseMII CTCAG 2 cut(s) 107, 137
BshVI ATCGAT 1 cut(s) 59
BsmAI GTCTC 1 cut(s) 174
BsmI GAATGC 2 cut(s) 82, 233
Bsp119I TTCGAA 1 cut(s) 353
Bsp143I GATC 1 cut(s) 342
BspCNI CTCAG 2 cut(s) 106, 136
BspDI ATCGAT 1 cut(s) 59
BspOI GCTAGC 1 cut(s) 17
BspT104I TTCGAA 1 cut(s) 353
BssMI GATC 1 cut(s) 342
BstBI TTCGAA 1 cut(s) 353
BstC8I GCNNGC 1 cut(s) 15
BstDEI CTNAG 3 cut(s) 93, 104, 123
BstKTI GATC 1 cut(s) 345
BstMAI GTCTC 1 cut(s) 174
BstMBI GATC 1 cut(s) 342
BstNSI RCATGY 1 cut(s) 393
Bsu15I ATCGAT 1 cut(s) 59
BsuTUI ATCGAT 1 cut(s) 59
Cac8I GCNNGC 1 cut(s) 15
ClaI ATCGAT 1 cut(s) 59
CviAII CATG 4 cut(s) 38, 173, 346, 390
CviJI RGCY 4 cut(s) 13, 17, 350, 368
CviKI_1 RGCY 4 cut(s) 13, 17, 350, 368
DdeI CTNAG 3 cut(s) 93, 104, 123
DpnI GATC 1 cut(s) 344
DpnII GATC 1 cut(s) 342
EcoRI GAATTC 1 cut(s) 355
EcoT22I ATGCAT 1 cut(s) 391
FaeI CATG 4 cut(s) 41, 176, 349, 393
FatI CATG 4 cut(s) 37, 172, 345, 389
FauNDI CATATG 2 cut(s) 46, 339
FbaI TGATCA 1 cut(s) 342
FspBI CTAG 3 cut(s) 14, 18, 365
Hin1II CATG 4 cut(s) 41, 176, 349, 393
HinfI GANTC 2 cut(s) 24, 121
HphI GGTGA 2 cut(s) 17, 351
Hpy188I TCNGA 1 cut(s) 96
HpyAV CCTTC 1 cut(s) 155
HpyCH4V TGCA 3 cut(s) 50, 80, 389
HpyF3I CTNAG 3 cut(s) 93, 104, 123
Hsp92II CATG 4 cut(s) 41, 176, 349, 393
Ksp22I TGATCA 1 cut(s) 342
Kzo9I GATC 1 cut(s) 342
MaeI CTAG 3 cut(s) 14, 18, 365
MaeIII GTNAC 1 cut(s) 238
MalI GATC 1 cut(s) 344
MboI GATC 1 cut(s) 342
MboII GAAGA 1 cut(s) 19
MluCI AATT 9 cut(s) 69, 84, 88, 115, 138, 295, 355, 377, 397
MlyI GAGTC 1 cut(s) 115
MnlI CCTC 2 cut(s) 14, 372
Mph1103I ATGCAT 1 cut(s) 391
MseI TTAA 4 cut(s) 87, 200, 293, 400
MslI CAYNNNNRTG 1 cut(s) 71
Mva1269I GAATGC 2 cut(s) 82, 233
NdeI CATATG 2 cut(s) 46, 339
NdeII GATC 1 cut(s) 342
NheI GCTAGC 1 cut(s) 13
NlaIII CATG 4 cut(s) 41, 176, 349, 393
NsiI ATGCAT 1 cut(s) 391
NspI RCATGY 1 cut(s) 393
NspV TTCGAA 1 cut(s) 353
PctI GAATGC 2 cut(s) 82, 233
PfeI GAWTC 1 cut(s) 24
PleI GAGTC 1 cut(s) 115
PpsI GAGTC 1 cut(s) 115
PshBI ATTAAT 1 cut(s) 87
PsiI TTATAA 1 cut(s) 267
RseI CAYNNNNRTG 1 cut(s) 71
SaqAI TTAA 4 cut(s) 87, 200, 293, 400
Sau3AI GATC 1 cut(s) 342
SchI GAGTC 1 cut(s) 115
SetI ASST 6 cut(s) 15, 19, 197, 293, 364, 370
SfuI TTCGAA 1 cut(s) 353
SgeI CNNG 7 cut(s) 26, 30, 50, 163, 185, 358, 377
SmiMI CAYNNNNRTG 1 cut(s) 71
SmlI CTYRAG 1 cut(s) 149
SmoI CTYRAG 1 cut(s) 149
Sse9I AATT 9 cut(s) 69, 84, 88, 115, 138, 295, 355, 377, 397
SspMI CTAG 3 cut(s) 14, 18, 365
TaqI TCGA 2 cut(s) 59, 353
TasI AATT 9 cut(s) 69, 84, 88, 115, 138, 295, 355, 377, 397
TfiI GAWTC 1 cut(s) 24
Tru1I TTAA 4 cut(s) 87, 200, 293, 400
Tru9I TTAA 4 cut(s) 87, 200, 293, 400
TspDTI ATGAA 5 cut(s) 54, 99, 180, 260, 268
VspI ATTAAT 1 cut(s) 87
XapI RAATTY 3 cut(s) 295, 355, 377
XceI RCATGY 1 cut(s) 393
XspI CTAG 3 cut(s) 14, 18, 365
Zsp2I ATGCAT 1 cut(s) 391
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.