pycom05g08210

No description available

Basic Information

Type: gene
Biological Identity
pyrus_communis
Chr5
Physical Location & Seq
Forward (+)
10914612 .. 10915255
644 bp
Loading structure...
UTR
Exon/CDS
Intron
pycom05g08210.2

Sequence Viewer

Length: 441 bp
ATGATAAGTGATGTGGTGATATGTGGGAGTGTGGCTGAAATGAAGGAGTGGAATGTTGGAATGGAACAAGGTTCCAACACTTTGGCTCCAAGCATAAGCTATCCATCCTTAGCCCAAAAGTGCTCCAAAAGTCTCCAAAATGCATCTTTTTGCTCCTTTAGCCCTTTGGACCTACAAACACACGAAAATAGCTTAAAACAAATCGATTTCCAGTTATTATTCCTACAAATCATGAATGACAATTTTCCTAATTTCATTGAATTAGACTCAGCGACGCAATCAAATTATTCTTATCAAGTTCCCTATATGAACAACATGATAGAGACACATATCAAAAACGATCGATCATTAAGTTCTATGAAAATCATAAGCATTGATAAGGCATTCTTAACTATGAACTACATGATACTCCTGCCAGGAATTTACTTAACACAATCATGA
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families
No domains found.

Protein Analysis

147

Amino Acids

16.51

Weight (kDa)

4.77

Isoelectric Point (pI)

50.48

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AcsI RAATTY 1 cut(s) 420
AgsI TTSAA 1 cut(s) 260
AjnI CCWGG 1 cut(s) 415
AluBI AGCT 2 cut(s) 99, 192
AluI AGCT 2 cut(s) 99, 192
Alw21I GWGCWC 1 cut(s) 125
Alw26I GTCTC 2 cut(s) 137, 317
ApoI RAATTY 1 cut(s) 420
AspS9I GGNCC 1 cut(s) 169
AsuHPI GGTGA 1 cut(s) 28
AvaII GGWCC 1 cut(s) 169
Bbv12I GWGCWC 1 cut(s) 125
BccI CCATC 1 cut(s) 112
BciT130I CCWGG 1 cut(s) 417
BcoDI GTCTC 2 cut(s) 137, 317
Bme1390I CCNGG 1 cut(s) 417
Bme18I GGWCC 1 cut(s) 169
BmgT120I GGNCC 1 cut(s) 169
BmiI GGNNCC 2 cut(s) 73, 87
BmrFI CCNGG 1 cut(s) 417
BmsI GCATC 1 cut(s) 152
Bpu10I CCTNAGC 1 cut(s) 109
Bsa29I ATCGAT 2 cut(s) 204, 343
BsaXI ACNNNNNCTCC 2 cut(s) 70, 100
Bse1I ACTGG 1 cut(s) 211
BseBI CCWGG 1 cut(s) 417
BseCI ATCGAT 2 cut(s) 204, 343
BseGI GGATG 1 cut(s) 104
BseMII CTCAG 1 cut(s) 282
BseNI ACTGG 1 cut(s) 211
Bsh1285I CGRYCG 1 cut(s) 343
BshVI ATCGAT 2 cut(s) 204, 343
BsiEI CGRYCG 1 cut(s) 343
BsiHKAI GWGCWC 1 cut(s) 125
BsmAI GTCTC 2 cut(s) 137, 317
BsmI GAATGC 1 cut(s) 383
Bsp1286I GDGCHC 1 cut(s) 125
Bsp143I GATC 2 cut(s) 340, 344
BspCNI CTCAG 1 cut(s) 281
BspDI ATCGAT 2 cut(s) 204, 343
BspHI TCATGA 2 cut(s) 231, 437
BspLI GGNNCC 2 cut(s) 73, 87
BsrI ACTGG 1 cut(s) 211
BssMI GATC 2 cut(s) 340, 344
Bst2UI CCWGG 1 cut(s) 417
BstDEI CTNAG 2 cut(s) 109, 268
BstF5I GGATG 1 cut(s) 104
BstKTI GATC 2 cut(s) 343, 347
BstMAI GTCTC 2 cut(s) 137, 317
BstMBI GATC 2 cut(s) 340, 344
BstMCI CGRYCG 1 cut(s) 343
BstMWI GCNNNNNNNGC 1 cut(s) 159
BstNI CCWGG 1 cut(s) 417
BstSCI CCNGG 1 cut(s) 415
BstXI CCANNNNNNTGG 1 cut(s) 82
Bsu15I ATCGAT 2 cut(s) 204, 343
BsuTUI ATCGAT 2 cut(s) 204, 343
BtsCI GGATG 1 cut(s) 104
CciI TCATGA 2 cut(s) 231, 437
Cfr13I GGNCC 1 cut(s) 169
ClaI ATCGAT 2 cut(s) 204, 343
CseI GACGC 1 cut(s) 283
CviAII CATG 4 cut(s) 232, 316, 403, 438
CviJI RGCY 6 cut(s) 35, 86, 99, 113, 162, 192
CviKI_1 RGCY 6 cut(s) 35, 86, 99, 113, 162, 192
DdeI CTNAG 2 cut(s) 109, 268
DpnI GATC 2 cut(s) 342, 346
DpnII GATC 2 cut(s) 340, 344
Eco47I GGWCC 1 cut(s) 169
EcoRII CCWGG 1 cut(s) 415
EcoT22I ATGCAT 1 cut(s) 145
FaeI CATG 4 cut(s) 235, 319, 406, 441
FalI AAGNNNNNCTT 2 cut(s) 371, 403
FatI CATG 4 cut(s) 231, 315, 402, 437
FokI GGATG 1 cut(s) 91
HgaI GACGC 1 cut(s) 283
Hin1II CATG 4 cut(s) 235, 319, 406, 441
HinfI GANTC 1 cut(s) 266
HphI GGTGA 1 cut(s) 28
Hpy188III TCNNGA 2 cut(s) 232, 438
Hpy99I CGWCG 1 cut(s) 277
HpyAV CCTTC 1 cut(s) 37
HpyCH4V TGCA 1 cut(s) 143
HpyF10VI GCNNNNNNNGC 1 cut(s) 159
HpyF3I CTNAG 2 cut(s) 109, 268
Hsp92II CATG 4 cut(s) 235, 319, 406, 441
Kzo9I GATC 2 cut(s) 340, 344
LmnI GCTCC 3 cut(s) 91, 128, 158
LpnPI CCDG 4 cut(s) 224, 402, 425, 429
LweI GCATC 1 cut(s) 152
MalI GATC 2 cut(s) 342, 346
MboI GATC 2 cut(s) 340, 344
MhlI GDGCHC 1 cut(s) 125
MluCI AATT 5 cut(s) 241, 250, 260, 283, 420
MlyI GAGTC 1 cut(s) 260
MmeI TCCRAC 2 cut(s) 37, 99
Mph1103I ATGCAT 1 cut(s) 145
MseI TTAA 4 cut(s) 194, 350, 389, 428
MslI CAYNNNNRTG 1 cut(s) 436
MspR9I CCNGG 1 cut(s) 417
Mva1269I GAATGC 1 cut(s) 383
MvaI CCWGG 1 cut(s) 417
MwoI GCNNNNNNNGC 1 cut(s) 159
NdeII GATC 2 cut(s) 340, 344
NlaIII CATG 4 cut(s) 235, 319, 406, 441
NlaIV GGNNCC 2 cut(s) 73, 87
NsiI ATGCAT 1 cut(s) 145
PagI TCATGA 2 cut(s) 231, 437
PctI GAATGC 1 cut(s) 383
Ple19I CGATCG 1 cut(s) 343
PleI GAGTC 1 cut(s) 260
PpsI GAGTC 1 cut(s) 260
Psp6I CCWGG 1 cut(s) 415
PspGI CCWGG 1 cut(s) 415
PspN4I GGNNCC 2 cut(s) 73, 87
PspPI GGNCC 1 cut(s) 169
PvuI CGATCG 1 cut(s) 343
RseI CAYNNNNRTG 1 cut(s) 436
SaqAI TTAA 4 cut(s) 194, 350, 389, 428
Sau3AI GATC 2 cut(s) 340, 344
Sau96I GGNCC 1 cut(s) 169
SchI GAGTC 1 cut(s) 260
ScrFI CCNGG 1 cut(s) 417
SduI GDGCHC 1 cut(s) 125
SetI ASST 4 cut(s) 73, 101, 174, 194
SfaNI GCATC 1 cut(s) 152
SinI GGWCC 1 cut(s) 169
SmiMI CAYNNNNRTG 1 cut(s) 436
Sse9I AATT 5 cut(s) 241, 250, 260, 283, 420
StyD4I CCNGG 1 cut(s) 415
TaqI TCGA 2 cut(s) 204, 343
TasI AATT 5 cut(s) 241, 250, 260, 283, 420
Tru1I TTAA 4 cut(s) 194, 350, 389, 428
Tru9I TTAA 4 cut(s) 194, 350, 389, 428
TspDTI ATGAA 6 cut(s) 56, 244, 248, 323, 374, 410
VpaK11BI GGWCC 1 cut(s) 169
XapI RAATTY 1 cut(s) 420
Zsp2I ATGCAT 1 cut(s) 145
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.