pycom13g24030

No description available

Basic Information

Type: gene
Biological Identity
pyrus_communis
Chr13
Physical Location & Seq
Forward (+)
21312815 .. 21313122
308 bp
Loading structure...
UTR
Exon/CDS
Intron
pycom13g24030.2

Sequence Viewer

Length: 243 bp
ATGTTCATTAAATTGGACCAACGACGCAATCAAATTATTCTTCTCAAGTTCCCTAACTATGAAAAGCATGATAGAGATACATCTCGAAGATCATTAAGTTCTGCGAAAATCATAAGCATTGACGAAGCATTCGTAACTATGGAAAGCATGCTACTCCTGCCAAGAGTGAAATTCCCTTACATTCTAGAATCAAATCCTTGCATGCAAACTAAGTATGCATCCTTAATAAACATACAAGAATAA
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families
No domains found.

Protein Analysis

81

Amino Acids

9.48

Weight (kDa)

9.25

Isoelectric Point (pI)

54.27

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AcsI RAATTY 1 cut(s) 170
ApoI RAATTY 1 cut(s) 170
ArsI GACNNNNNNTTYG 2 cut(s) 113, 145
AspS9I GGNCC 1 cut(s) 16
AvaII GGWCC 1 cut(s) 16
BfaI CTAG 1 cut(s) 185
Bme18I GGWCC 1 cut(s) 16
BmgT120I GGNCC 1 cut(s) 16
BmsI GCATC 1 cut(s) 227
BpuEI CTTGAG 1 cut(s) 29
BseGI GGATG 1 cut(s) 218
BsmI GAATGC 1 cut(s) 128
Bsp143I GATC 1 cut(s) 89
BssMI GATC 1 cut(s) 89
BstC8I GCNNGC 2 cut(s) 149, 203
BstDEI CTNAG 1 cut(s) 210
BstF5I GGATG 1 cut(s) 218
BstKTI GATC 1 cut(s) 92
BstMBI GATC 1 cut(s) 89
BstMWI GCNNNNNNNGC 1 cut(s) 157
BstNSI RCATGY 2 cut(s) 151, 205
BtsCI GGATG 1 cut(s) 218
Cac8I GCNNGC 2 cut(s) 149, 203
Cfr13I GGNCC 1 cut(s) 16
CseI GACGC 1 cut(s) 33
CviAII CATG 3 cut(s) 68, 148, 202
DdeI CTNAG 1 cut(s) 210
DpnI GATC 1 cut(s) 91
DpnII GATC 1 cut(s) 89
Eco47I GGWCC 1 cut(s) 16
EcoT22I ATGCAT 1 cut(s) 220
FaeI CATG 3 cut(s) 71, 151, 205
FaiI YATR 8 cut(s) 60, 69, 113, 140, 149, 203, 216, 233
FatI CATG 3 cut(s) 67, 147, 201
FokI GGATG 1 cut(s) 205
FspBI CTAG 1 cut(s) 185
HgaI GACGC 1 cut(s) 33
Hin1II CATG 3 cut(s) 71, 151, 205
HinfI GANTC 1 cut(s) 188
Hpy188III TCNNGA 2 cut(s) 84, 185
Hpy99I CGWCG 1 cut(s) 27
HpyCH4V TGCA 3 cut(s) 201, 205, 218
HpyF10VI GCNNNNNNNGC 1 cut(s) 157
HpyF3I CTNAG 1 cut(s) 210
Hsp92II CATG 3 cut(s) 71, 151, 205
Kzo9I GATC 1 cut(s) 89
LpnPI CCDG 1 cut(s) 170
LweI GCATC 1 cut(s) 227
MaeI CTAG 1 cut(s) 185
MaeIII GTNAC 1 cut(s) 133
MalI GATC 1 cut(s) 91
MboI GATC 1 cut(s) 89
MboII GAAGA 2 cut(s) 32, 99
MluCI AATT 3 cut(s) 11, 33, 170
Mph1103I ATGCAT 1 cut(s) 220
MseI TTAA 3 cut(s) 9, 95, 224
Mva1269I GAATGC 1 cut(s) 128
MwoI GCNNNNNNNGC 1 cut(s) 157
NdeII GATC 1 cut(s) 89
NlaIII CATG 3 cut(s) 71, 151, 205
NsiI ATGCAT 1 cut(s) 220
NspI RCATGY 2 cut(s) 151, 205
PaeI GCATGC 2 cut(s) 151, 205
PcsI WCGNNNNNNNCGW 1 cut(s) 129
PctI GAATGC 1 cut(s) 128
PfeI GAWTC 1 cut(s) 188
PspPI GGNCC 1 cut(s) 16
SaqAI TTAA 3 cut(s) 9, 95, 224
Sau3AI GATC 1 cut(s) 89
Sau96I GGNCC 1 cut(s) 16
SfaNI GCATC 1 cut(s) 227
SgeI CNNG 9 cut(s) 58, 80, 96, 160, 169, 174, 197, 210, 214
SinI GGWCC 1 cut(s) 16
SmlI CTYRAG 1 cut(s) 44
SmoI CTYRAG 1 cut(s) 44
SphI GCATGC 2 cut(s) 151, 205
Sse9I AATT 3 cut(s) 11, 33, 170
SspMI CTAG 1 cut(s) 185
TaqI TCGA 1 cut(s) 85
TasI AATT 3 cut(s) 11, 33, 170
TfiI GAWTC 1 cut(s) 188
Tru1I TTAA 3 cut(s) 9, 95, 224
Tru9I TTAA 3 cut(s) 9, 95, 224
TspDTI ATGAA 1 cut(s) 75
VpaK11BI GGWCC 1 cut(s) 16
XapI RAATTY 1 cut(s) 170
XbaI TCTAGA 1 cut(s) 184
XceI RCATGY 2 cut(s) 151, 205
XspI CTAG 1 cut(s) 185
Zsp2I ATGCAT 1 cut(s) 220
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.