pycom01g01370

No description available

Design Primers CRISPR Design

Basic Information

Type: gene
Biological Identity
pyrus_communis
Chr1
OG0000608
Physical Location & Seq
Forward (+)
1300819 .. 1301004
186 bp
Loading structure...
UTR
Exon/CDS
Intron
pycom01g01370.1

Sequence Viewer

Length: 186 bp
ATGCAATTCAAAACATTCTCCAAAAGTCCTTTACGTGAAAAGCACAATAAAGATACAATCAAAGATCGATTAAACCTCATGAAAACTATAAGTGTTGACGAGGCATTCGTTACTATGATGAGCATGAAACTAGTGCTAAGAATTCATTTAACGCGATTGTTTATAAGCAACCTCCACTACTTGTGA
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families
No domains found.

Protein Analysis

62

Amino Acids

7.31

Weight (kDa)

10.21

Isoelectric Point (pI)

33.82

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready
iTOL Interactive Tree Of Life · Most popular EvolView Flexible annotations MEGA Desktop phylogenetics suite FigTree Desktop tree editor

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AanI TTATAA 1 cut(s) 164
AccII CGCG 1 cut(s) 154
AcsI RAATTY 1 cut(s) 141
AgsI TTSAA 1 cut(s) 10
AhlI ACTAGT 1 cut(s) 130
ApoI RAATTY 1 cut(s) 141
ArsI GACNNNNNNTTYG 2 cut(s) 89, 121
BcuI ACTAGT 1 cut(s) 130
BfaI CTAG 1 cut(s) 131
Bsa29I ATCGAT 1 cut(s) 67
BsaAI YACGTR 1 cut(s) 35
BseCI ATCGAT 1 cut(s) 67
Bsh1236I CGCG 1 cut(s) 154
BshVI ATCGAT 1 cut(s) 67
BsmI GAATGC 1 cut(s) 104
Bsp143I GATC 1 cut(s) 64
BspDI ATCGAT 1 cut(s) 67
BspFNI CGCG 1 cut(s) 154
BspHI TCATGA 1 cut(s) 78
BssMI GATC 1 cut(s) 64
BstBAI YACGTR 1 cut(s) 35
BstDEI CTNAG 1 cut(s) 137
BstFNI CGCG 1 cut(s) 154
BstKTI GATC 1 cut(s) 67
BstMBI GATC 1 cut(s) 64
BstUI CGCG 1 cut(s) 154
Bsu15I ATCGAT 1 cut(s) 67
BsuTUI ATCGAT 1 cut(s) 67
CciI TCATGA 1 cut(s) 78
ClaI ATCGAT 1 cut(s) 67
CviAII CATG 2 cut(s) 79, 124
DdeI CTNAG 1 cut(s) 137
DpnI GATC 1 cut(s) 66
DpnII GATC 1 cut(s) 64
EcoRI GAATTC 1 cut(s) 141
FaeI CATG 2 cut(s) 82, 127
FaiI YATR 5 cut(s) 80, 89, 116, 125, 164
FatI CATG 2 cut(s) 78, 123
FspBI CTAG 1 cut(s) 131
FspEI CC 4 cut(s) 34, 42, 86, 89
Hin1II CATG 2 cut(s) 82, 127
HincII GTYRAC 1 cut(s) 97
HindII GTYRAC 1 cut(s) 97
Hpy166II GTNNAC 1 cut(s) 97
Hpy188III TCNNGA 1 cut(s) 79
Hpy8I GTNNAC 1 cut(s) 97
HpyCH4IV ACGT 1 cut(s) 34
HpyCH4V TGCA 1 cut(s) 4
HpyF3I CTNAG 1 cut(s) 137
HpySE526I ACGT 1 cut(s) 34
Hsp92II CATG 2 cut(s) 82, 127
Kzo9I GATC 1 cut(s) 64
MaeI CTAG 1 cut(s) 131
MaeII ACGT 1 cut(s) 34
MaeIII GTNAC 1 cut(s) 109
MalI GATC 1 cut(s) 66
MboI GATC 1 cut(s) 64
MluCI AATT 2 cut(s) 5, 141
MnlI CCTC 3 cut(s) 86, 94, 182
MseI TTAA 2 cut(s) 71, 149
Mva1269I GAATGC 1 cut(s) 104
MvnI CGCG 1 cut(s) 154
NdeII GATC 1 cut(s) 64
NlaIII CATG 2 cut(s) 82, 127
PagI TCATGA 1 cut(s) 78
PcsI WCGNNNNNNNCGW 1 cut(s) 105
PctI GAATGC 1 cut(s) 104
Ppu21I YACGTR 1 cut(s) 35
PsiI TTATAA 1 cut(s) 164
SaqAI TTAA 2 cut(s) 71, 149
Sau3AI GATC 1 cut(s) 64
SetI ASST 3 cut(s) 37, 78, 174
SgeI CNNG 6 cut(s) 47, 91, 112, 136, 143, 165
SpeI ACTAGT 1 cut(s) 130
Sse9I AATT 2 cut(s) 5, 141
SspMI CTAG 1 cut(s) 131
TaiI ACGT 1 cut(s) 37
TaqI TCGA 1 cut(s) 67
TasI AATT 2 cut(s) 5, 141
Tru1I TTAA 2 cut(s) 71, 149
Tru9I TTAA 2 cut(s) 71, 149
TspDTI ATGAA 3 cut(s) 95, 134, 140
XapI RAATTY 1 cut(s) 141
XspI CTAG 1 cut(s) 131
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.