Basic Information

Type: gene

Biological Identity

Species

pyrus_communis

Chromosome

tig00000808

Orthogroup ID

OG0000608

Physical Location & Seq

Genomic Coordinates Forward (+)

286583 .. 288244

Gene Structure 1662 bp

Loading structure...

UTR

Exon/CDS

Intron

Transcript / Protein ID

pycom808g00490.5

Sequence Viewer

CDS Protein Promoter (2k)

Length: 1317 bp

ATGCTAATATGGGGATTAACAAGTTTTAATCTTGTAGCTGGTGTGGTTACGTTATGGTGGGGGAGAGAAGCAGGGAATAGCTGCCCATCCAGCTGCAGTATAGTAAGGACTAGGGGTGAATTTTTTTGTCAAATTATCGTGCTAATTGAATTGTCAACTGTGTCATATCGATTTTGTACTAATCGATCATTATCACAGTATTACCGTACTGTACCTAAAATATATTATAATTTAAATTATATAATATATAATTATATTAACTCATATTTATATTATTCCATTTTGTATAATGAGTATAGGAGGGGTTCTTCTACTACCATTGGGGCTCTATTGGAAGATGTGGAACTGAATGAGGAGTTCATAATTCAAGCTTGTGGGGGTGATGAGAACAAAATTGAAATGCTGAAAGAGCTTAAACAAGAAAGGAGGGAGCAACACCTTTTGGATATATCCAATAAAGTTGATAAGTACTTTGCCGCTCCTTATATTAGCATTGTTGTTGGTGGCTTTGATCTCTTAAGTTGGTGGAAATTAAACACAAAACAGTTATCAATTCTTTCACAATTTTTCCTCTTCCCAGTTTTTTCCTCTATTCTCCATCATGATCAGGACCTAGACACTCTTGTTACCATTATTCCTACTCAATTAATTCCTCAGATCCATCCAACCATCCCTCTGTCTTCTGTTTCCCATCCATCCCCCATGAATCCAATCTCCTTTATCTTCGATTTGGCTCCATCCTTCATCGGTTTATACCCATATTCGAAGGTGTGTAGAGTTTCGGTATGCATATCGGCTCGGGTGTCTATGCCATCTCCTTTTCTCGGTTTGCCTTTATTGCCAGTGTTGCTTGTGGGAATCTCACATGCATCTTTATTTTCTTCTCCTTGGTGGTTGTGTTCGGAGAGGGTTTCTTTGATGGATCATGGGATCTTCCCTCCTCCCATCTCTGACGTGTTGATTGGTCAGAATTCTAACGTATATTGGTGTCCATGGTTCCTGCTGCTCGTGTGGTGTTGTAGAGTGATGCGAGATTTATACGCGCACAAATTAAACCCTCTTTTCGTCAAATTGTATGTTAATCACTTGGATTTGACTCAAAAACGTAAAAACGTAATAATAAACACTAAACTAGACTCAAAGAATGTAAAACTAAACTTTAAAACACTAAGACAAACCAAAGACTCAAAATTAAAGGGGGATTTAAGTTTATACGAAATTAAATTAAATGAACAAATTAAAACAGAATCTAAGGGGTTCATCTCCATACATGTTACACTTGCATACAAGATTGATTCTCAGTTGGTCTTTCGATAA

Functional Annotation

Gene Ontology

Molecular Function
Biological Process
Cellular Component

No ontology terms assigned.

KEGG Pathways

Metabolic & Signaling

No pathways identified.

Pfam Domains

Protein Families

DUF4413 Dimer_Tnp_hAT zf-BED

Protein Analysis

439

Amino Acids

50.4

Weight (kDa)

8.8

Isoelectric Point (pI)

37.13

Instability Index

Protein Domains (Pfam)

No Pfam domains detected for this protein.

Hydrophobicity Profile (Kyte-Doolittle)

AI Structure Prediction Report

Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter

Style Settings

Font Size (px)

Line Width

Align Labels (Cladogram)

Image

Tree File

Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

iTOL Interactive Tree Of Life · Most popular EvolView Flexible annotations MEGA Desktop phylogenetics suite FigTree Desktop tree editor

Orthologous Genes (Group: OG0000608)

Species	Orthologous Gene IDs
malus_domestica	MD01G1168300.v1.1 MD07G1127200.v1.1
prunus_persica	Prupe.5G065800_v2.0.a1
pyrus_communis	pycom01g00450 pycom01g00530 pycom01g00860 pycom01g01270 pycom01g01320 pycom01g01350 pycom01g01370 pycom01g01420 pycom01g01440 pycom01g01750 pycom01g02240 pycom01g02250 pycom01g02980 pycom01g03610 pycom01g04360 pycom03g18640 pycom05g08190 pycom05g08210 pycom05g08250 pycom05g08270 pycom05g22500 pycom11g13900 pycom12424g00150 pycom12426g00120 pycom12426g00140 pycom12426g00190 pycom12426g00200 pycom12426g00480 pycom1256g00170 pycom1256g00250 pycom12659g00080 pycom12659g00170 pycom12659g00200 pycom12661g00070 pycom12661g00120 pycom12g04960 pycom1341g00040 pycom13g23150 pycom13g23290 pycom13g24030 pycom13g24710 pycom13g25450 pycom13g25530 pycom13g25630 pycom13g25650 pycom13g25850 pycom13g25920 pycom13g26130 pycom13g26150 pycom13g26180 pycom13g26190 pycom13g26310 pycom13g27290 pycom13g28010 pycom13g28180 pycom1654g00090 pycom1654g00100 pycom17g16670 pycom17g16980 pycom17g17190 pycom17g17210 pycom17g17290 pycom17g17520 pycom17g17750 pycom17g17770 pycom17g17820 pycom17g18030 pycom17g18060 pycom17g18070 pycom17g18240 pycom280g00030 pycom436g00360 pycom520g00110 pycom520g01100 pycom808g00240 pycom808g00490 pycom808g00610

Restriction Enzyme Sites

1 / 10

Enzyme	Recognition Site	Cut Count	Positions (bp)
AanI	TTATAA	1 cut(s)	228
AccBSI	CCGCTC	1 cut(s)	479
AccII	CGCG	1 cut(s)	1043
AciI	CCGC	1 cut(s)	477
AclWI	GGATC	3 cut(s)	652, 930, 938
AcsI	RAATTY	2 cut(s)	119, 970
AfaI	GTAC	4 cut(s)	178, 208, 213, 470
AfiI	CCNNNNNNNGG	1 cut(s)	824
AflII	CTTAAG	1 cut(s)	517
AflIII	ACRYGT	2 cut(s)	954, 1270
AgsI	TTSAA	3 cut(s)	149, 368, 398
AjiI	CACGTC	1 cut(s)	955
AluBI	AGCT	5 cut(s)	38, 81, 93, 371, 412
AluI	AGCT	5 cut(s)	38, 81, 93, 371, 412
AlwI	GGATC	3 cut(s)	652, 930, 938
Ama87I	CYCGRG	1 cut(s)	798
ApeKI	GCWGC	3 cut(s)	81, 93, 1003
ApoI	RAATTY	2 cut(s)	119, 970
AseI	ATTAAT	1 cut(s)	647
AspLEI	GCGC	1 cut(s)	1045
AspS9I	GGNCC	1 cut(s)	610
AsuHPI	GGTGA	2 cut(s)	128, 392
AsuII	TTCGAA	1 cut(s)	764
AvaI	CYCGRG	1 cut(s)	798
AvaII	GGWCC	1 cut(s)	610
BanII	GRGCYC	1 cut(s)	328
BauI	CACGAG	1 cut(s)	1007
BbsI	GAAGAC	1 cut(s)	672
BbvI	GCAGC	3 cut(s)	68, 80, 990
BclI	TGATCA	1 cut(s)	604
BfaI	CTAG	3 cut(s)	111, 614, 1133
BfmI	CTRYAG	1 cut(s)	94
BfrI	CTTAAG	1 cut(s)	517
BisI	GCNGC	4 cut(s)	82, 94, 477, 1004
BlsI	GCNGC	4 cut(s)	83, 95, 478, 1005
BmcAI	AGTACT	1 cut(s)	470
Bme18I	GGWCC	1 cut(s)	610
BmeT110I	CYCGRG	1 cut(s)	798
BmgBI	CACGTC	1 cut(s)	955
BmgT120I	GGNCC	1 cut(s)	610
BmiI	GGNNCC	2 cut(s)	735, 998
BmrI	ACTGGG	1 cut(s)	572
BmsI	GCATC	2 cut(s)	878, 1017
BmuI	ACTGGG	1 cut(s)	572
BpiI	GAAGAC	1 cut(s)	672
Bpu14I	TTCGAA	1 cut(s)	764
Bsa29I	ATCGAT	2 cut(s)	169, 184
BsaBI	GATNNNNATC	1 cut(s)	190
BsaJI	CCNNGG	2 cut(s)	887, 992
Bsc4I	CCNNNNNNNGG	1 cut(s)	824
Bse1I	ACTGG	2 cut(s)	578, 842
Bse8I	GATNNNNATC	1 cut(s)	190
BseCI	ATCGAT	2 cut(s)	169, 184
BseDI	CCNNGG	2 cut(s)	887, 992
BseGI	GGATG	6 cut(s)	86, 661, 669, 691, 695, 737
BseJI	GATNNNNATC	1 cut(s)	190
BseLI	CCNNNNNNNGG	1 cut(s)	824
BseMII	CTCAG	2 cut(s)	668, 1313
BseNI	ACTGG	2 cut(s)	578, 842
BseRI	GAGGAG	2 cut(s)	368, 930
BseXI	GCAGC	3 cut(s)	68, 80, 990
Bsh1236I	CGCG	1 cut(s)	1043
BshVI	ATCGAT	2 cut(s)	169, 184
BsiHKCI	CYCGRG	1 cut(s)	798
BslI	CCNNNNNNNGG	1 cut(s)	824
BsoBI	CYCGRG	1 cut(s)	798
Bsp119I	TTCGAA	1 cut(s)	764
Bsp1286I	GDGCHC	1 cut(s)	328
Bsp143I	GATC	6 cut(s)	185, 511, 604, 657, 922, 930
Bsp19I	CCATGG	1 cut(s)	992
BspACI	CCGC	1 cut(s)	477
BspCNI	CTCAG	2 cut(s)	667, 1312
BspDI	ATCGAT	2 cut(s)	169, 184
BspFNI	CGCG	1 cut(s)	1043
BspHI	TCATGA	1 cut(s)	601
BspLI	GGNNCC	2 cut(s)	735, 998
BspMAI	CTGCAG	1 cut(s)	98
BspPI	GGATC	3 cut(s)	652, 930, 938
BspT104I	TTCGAA	1 cut(s)	764
BspTI	CTTAAG	1 cut(s)	517
BsrBI	CCGCTC	1 cut(s)	479
BsrI	ACTGG	2 cut(s)	578, 842
BssECI	CCNNGG	2 cut(s)	887, 992
BssMI	GATC	6 cut(s)	185, 511, 604, 657, 922, 930
BssSI	CACGAG	1 cut(s)	1007
BssT1I	CCWWGG	2 cut(s)	887, 992
Bst2BI	CACGAG	1 cut(s)	1007
Bst4CI	ACNGT	5 cut(s)	160, 198, 206, 211, 546
Bst6I	CTCTTC	1 cut(s)	578
BstAFI	CTTAAG	1 cut(s)	517
BstBI	TTCGAA	1 cut(s)	764
BstDEI	CTNAG	4 cut(s)	654, 1169, 1251, 1299
BstDSI	CCRYGG	1 cut(s)	992
BstF5I	GGATG	6 cut(s)	86, 661, 669, 691, 695, 737
BstFNI	CGCG	1 cut(s)	1043
BstHHI	GCGC	1 cut(s)	1045
BstKTI	GATC	6 cut(s)	188, 514, 607, 660, 925, 933
BstMBI	GATC	6 cut(s)	185, 511, 604, 657, 922, 930
BstMWI	GCNNNNNNNGC	4 cut(s)	90, 409, 838, 847
BstNSI	RCATGY	2 cut(s)	869, 1274
BstSFI	CTRYAG	1 cut(s)	94
BstUI	CGCG	1 cut(s)	1043
BstV1I	GCAGC	3 cut(s)	68, 80, 990
BstV2I	GAAGAC	1 cut(s)	672
BstX2I	RGATCY	2 cut(s)	657, 930
BstYI	RGATCY	2 cut(s)	657, 930
Bsu15I	ATCGAT	2 cut(s)	169, 184
BsuTUI	ATCGAT	2 cut(s)	169, 184
BtgI	CCRYGG	1 cut(s)	992
BtrI	CACGTC	1 cut(s)	955
BtsCI	GGATG	6 cut(s)	86, 661, 669, 691, 695, 737
BtsIMutI	CAGTG	1 cut(s)	849
CciI	TCATGA	1 cut(s)	601
CfoI	GCGC	1 cut(s)	1045
Cfr13I	GGNCC	1 cut(s)	610
ClaI	ATCGAT	2 cut(s)	169, 184
Csp6I	GTAC	4 cut(s)	177, 207, 212, 469
CviAII	CATG	6 cut(s)	602, 703, 866, 926, 993, 1271
CviJI	RGCY	9 cut(s)	38, 81, 93, 326, 371, 412, 507, 734, 797
CviKI_1	RGCY	9 cut(s)	38, 81, 93, 326, 371, 412, 507, 734, 797
CviQI	GTAC	4 cut(s)	177, 207, 212, 469
DdeI	CTNAG	4 cut(s)	654, 1169, 1251, 1299
DpnI	GATC	6 cut(s)	187, 513, 606, 659, 924, 932
DpnII	GATC	6 cut(s)	185, 511, 604, 657, 922, 930
DraI	TTTAAA	2 cut(s)	234, 1162
Eam1104I	CTCTTC	1 cut(s)	578
EarI	CTCTTC	1 cut(s)	578
Eco130I	CCWWGG	2 cut(s)	887, 992
Eco24I	GRGCYC	1 cut(s)	328
Eco47I	GGWCC	1 cut(s)	610
Eco88I	CYCGRG	1 cut(s)	798
EcoO109I	RGGNCCY	1 cut(s)	610
EcoRI	GAATTC	1 cut(s)	970
EcoT14I	CCWWGG	2 cut(s)	887, 992
EcoT22I	ATGCAT	2 cut(s)	791, 871
EcoT38I	GRGCYC	1 cut(s)	328
ErhI	CCWWGG	2 cut(s)	887, 992
FaeI	CATG	6 cut(s)	605, 706, 869, 929, 996, 1274
FatI	CATG	6 cut(s)	601, 702, 865, 925, 992, 1270
FbaI	TGATCA	1 cut(s)	604
Fnu4HI	GCNGC	4 cut(s)	82, 94, 477, 1004
FokI	GGATG	6 cut(s)	73, 648, 656, 678, 682, 724
FriOI	GRGCYC	1 cut(s)	328
Fsp4HI	GCNGC	4 cut(s)	82, 94, 477, 1004
FspBI	CTAG	3 cut(s)	111, 614, 1133
GlaI	GCGC	1 cut(s)	1044
GluI	GCNGC	4 cut(s)	82, 94, 477, 1004
HhaI	GCGC	1 cut(s)	1045
Hin1II	CATG	6 cut(s)	605, 706, 869, 929, 996, 1274
Hin6I	GCGC	1 cut(s)	1043
HinP1I	GCGC	1 cut(s)	1043
HincII	GTYRAC	1 cut(s)	156
HindII	GTYRAC	1 cut(s)	156
HindIII	AAGCTT	1 cut(s)	369
HinfI	GANTC	7 cut(s)	706, 858, 1096, 1136, 1184, 1247, 1295
HphI	GGTGA	2 cut(s)	128, 392
Hpy166II	GTNNAC	1 cut(s)	156
Hpy188I	TCNGA	4 cut(s)	657, 904, 952, 969
Hpy188III	TCNNGA	2 cut(s)	602, 608
Hpy8I	GTNNAC	1 cut(s)	156
HpyAV	CCTTC	2 cut(s)	751, 760
HpyCH4III	ACNGT	5 cut(s)	160, 198, 206, 211, 546
HpyCH4IV	ACGT	5 cut(s)	50, 954, 978, 1105, 1113
HpyCH4V	TGCA	4 cut(s)	96, 789, 869, 1283
HpyF10VI	GCNNNNNNNGC	4 cut(s)	90, 409, 838, 847
HpyF3I	CTNAG	4 cut(s)	654, 1169, 1251, 1299
HpySE526I	ACGT	5 cut(s)	50, 954, 978, 1105, 1113
Hsp92II	CATG	6 cut(s)	605, 706, 869, 929, 996, 1274
HspAI	GCGC	1 cut(s)	1043
Ksp22I	TGATCA	1 cut(s)	604
Kzo9I	GATC	6 cut(s)	185, 511, 604, 657, 922, 930
LmnI	GCTCC	3 cut(s)	430, 484, 739
LpnPI	CCDG	7 cut(s)	24, 57, 103, 591, 593, 855, 1013
Lsp1109I	GCAGC	3 cut(s)	68, 80, 990
LweI	GCATC	2 cut(s)	878, 1017
MaeI	CTAG	3 cut(s)	111, 614, 1133
MaeII	ACGT	5 cut(s)	50, 954, 978, 1105, 1113
MaeIII	GTNAC	3 cut(s)	46, 625, 1273
MalI	GATC	6 cut(s)	187, 513, 606, 659, 924, 932
MbiI	CCGCTC	1 cut(s)	479
MboI	GATC	6 cut(s)	185, 511, 604, 657, 922, 930
MboII	GAAGA	7 cut(s)	300, 347, 565, 672, 715, 873, 925
MflI	RGATCY	2 cut(s)	657, 930
MhlI	GDGCHC	1 cut(s)	328
MlyI	GAGTC	3 cut(s)	1090, 1130, 1178
MmeI	TCCRAC	1 cut(s)	689
Mph1103I	ATGCAT	2 cut(s)	791, 871
MspA1I	CMGCKG	1 cut(s)	93
MspCI	CTTAAG	1 cut(s)	517
MvnI	CGCG	1 cut(s)	1043
MwoI	GCNNNNNNNGC	4 cut(s)	90, 409, 838, 847
NcoI	CCATGG	1 cut(s)	992
NdeII	GATC	6 cut(s)	185, 511, 604, 657, 922, 930
NlaIII	CATG	6 cut(s)	605, 706, 869, 929, 996, 1274
NlaIV	GGNNCC	2 cut(s)	735, 998
NsiI	ATGCAT	2 cut(s)	791, 871
NspI	RCATGY	2 cut(s)	869, 1274
NspV	TTCGAA	1 cut(s)	764
PagI	TCATGA	1 cut(s)	601
PciI	ACATGT	1 cut(s)	1270
PfeI	GAWTC	4 cut(s)	706, 858, 1247, 1295
PkrI	GCNGC	4 cut(s)	83, 95, 478, 1005
PleI	GAGTC	3 cut(s)	1090, 1130, 1178
PpsI	GAGTC	3 cut(s)	1090, 1130, 1178
PpuMI	RGGWCCY	1 cut(s)	610
PscI	ACATGT	1 cut(s)	1270
PshBI	ATTAAT	1 cut(s)	647
PsiI	TTATAA	1 cut(s)	228
Psp5II	RGGWCCY	1 cut(s)	610
PspN4I	GGNNCC	2 cut(s)	735, 998
PspPI	GGNCC	1 cut(s)	610
PspPPI	RGGWCCY	1 cut(s)	610
PstI	CTGCAG	1 cut(s)	98
PsuI	RGATCY	2 cut(s)	657, 930
PvuII	CAGCTG	1 cut(s)	93
RsaI	GTAC	4 cut(s)	178, 208, 213, 470
RsaNI	GTAC	4 cut(s)	177, 207, 212, 469
SatI	GCNGC	4 cut(s)	82, 94, 477, 1004
Sau3AI	GATC	6 cut(s)	185, 511, 604, 657, 922, 930
Sau96I	GGNCC	1 cut(s)	610
ScaI	AGTACT	1 cut(s)	470
SchI	GAGTC	3 cut(s)	1090, 1130, 1178
SduI	GDGCHC	1 cut(s)	328
SfaNI	GCATC	2 cut(s)	878, 1017
SfcI	CTRYAG	1 cut(s)	94
SfuI	TTCGAA	1 cut(s)	764
SinI	GGWCC	1 cut(s)	610
SmiI	ATTTAAAT	1 cut(s)	234
SmlI	CTYRAG	1 cut(s)	517
SmoI	CTYRAG	1 cut(s)	517
SsiI	CCGC	1 cut(s)	477
SspMI	CTAG	3 cut(s)	111, 614, 1133
StyI	CCWWGG	2 cut(s)	887, 992
SwaI	ATTTAAAT	1 cut(s)	234
TaaI	ACNGT	5 cut(s)	160, 198, 206, 211, 546
TaiI	ACGT	5 cut(s)	53, 957, 981, 1108, 1116
TaqI	TCGA	5 cut(s)	169, 184, 726, 764, 1312
TatI	WGTACW	2 cut(s)	176, 468
TauI	GCSGC	1 cut(s)	479
TfiI	GAWTC	4 cut(s)	706, 858, 1247, 1295
TscAI	CASTG	1 cut(s)	849
TseI	GCWGC	3 cut(s)	81, 93, 1003
TspDTI	ATGAA	5 cut(s)	349, 719, 733, 1245, 1249
TspRI	CASTG	1 cut(s)	849
Vha464I	CTTAAG	1 cut(s)	517
VpaK11BI	GGWCC	1 cut(s)	610
VspI	ATTAAT	1 cut(s)	647
XapI	RAATTY	2 cut(s)	119, 970
XceI	RCATGY	2 cut(s)	869, 1274
XspI	CTAG	3 cut(s)	111, 614, 1133
ZrmI	AGTACT	1 cut(s)	470
Zsp2I	ATGCAT	2 cut(s)	791, 871

Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.