pycom01g01420

No description available

Basic Information

Type: gene
Biological Identity
pyrus_communis
Chr1
Physical Location & Seq
Forward (+)
1355770 .. 1356949
1180 bp
Loading structure...
UTR
Exon/CDS
Intron
pycom01g01420.10

Sequence Viewer

Length: 672 bp
ATGTGTGCCGCACCTAGCCTTCTAGAACTCCCAAATTCCTATAGGCAATCTTTTTCCTTTACTAAAGATATAAGTAGGGATCGTTCTGGACCGGGAATTAGGAGGGATTCTCACAAGACTCTTACTAACTTACTTAATTTGGACGATAATACACTTGGTTTTGACTCTAACGACTCAAAAAGACTCTTTTGGACAGATTTGGAACAAGTAAGAAAAGGGGTTTTGATTTTGGACGAATTTAAAAGAAAACAACCAAGGGATACTTCTCCACACAAGATACTTTCAAAACATAAATTGATTTCCAGTTGCTTTTCCGATAAACCATTGATGCGAAAATATAAGGATGCAAGTAGGGATCGTTCTGGACCGGGGATTAGGAGGTTAAAAACGTTCACAAAGACTCAAAGGACTCGAAACAAGTTCAAAAGACTCAAAACTGTTGATTCAAAACACTTTAAAACACAAACTAAACAGATTCTAAACACTATAGAACAAGAAAGTAAAGGGGGAAAAACTAGGCAGATTGTAAAACGAATTTTTGGAAACAAGATGATGGATGGATTAGTTAGAGGTCCATTCTCCACACATGACACATTTGTATATGAATCGATTGTCCAATTGATTTTCACTAACTATGATGCTCAACACCCCAAGTTAACCGTGATGCACTAA
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families
No domains found.

Protein Analysis

224

Amino Acids

25.94

Weight (kDa)

10.26

Isoelectric Point (pI)

49.01

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AciI CCGC 1 cut(s) 9
AclI AACGTT 1 cut(s) 389
AclWI GGATC 2 cut(s) 87, 363
AcsI RAATTY 3 cut(s) 34, 236, 534
AgsI TTSAA 3 cut(s) 285, 424, 447
AjuI GAANNNNNNNTTGG 2 cut(s) 247, 279
AlwI GGATC 2 cut(s) 87, 363
ApoI RAATTY 3 cut(s) 34, 236, 534
AspS9I GGNCC 3 cut(s) 89, 365, 572
AsuC2I CCSGG 2 cut(s) 93, 369
AvaII GGWCC 3 cut(s) 89, 365, 572
BccI CCATC 2 cut(s) 547, 551
BciVI GTATCC 1 cut(s) 253
BcnI CCSGG 2 cut(s) 93, 369
BfaI CTAG 3 cut(s) 15, 23, 516
BfmI CTRYAG 2 cut(s) 40, 486
BfuI GTATCC 1 cut(s) 253
BisI GCNGC 1 cut(s) 9
BlsI GCNGC 1 cut(s) 10
Bme1390I CCNGG 2 cut(s) 93, 369
Bme18I GGWCC 3 cut(s) 89, 365, 572
BmgT120I GGNCC 3 cut(s) 89, 365, 572
BmrFI CCNGG 2 cut(s) 93, 369
BmsI GCATC 4 cut(s) 318, 334, 628, 654
BplI GAGNNNNNCTC 2 cut(s) 94, 126
BpuMI CCSGG 2 cut(s) 93, 369
Bsa29I ATCGAT 1 cut(s) 608
BsaJI CCNNGG 2 cut(s) 254, 368
Bse1I ACTGG 1 cut(s) 303
BseCI ATCGAT 1 cut(s) 608
BseDI CCNNGG 2 cut(s) 254, 368
BseGI GGATG 2 cut(s) 349, 562
BseNI ACTGG 1 cut(s) 303
BshVI ATCGAT 1 cut(s) 608
BsiSI CCGG 2 cut(s) 92, 368
Bsp143I GATC 2 cut(s) 79, 355
BspACI CCGC 1 cut(s) 9
BspDI ATCGAT 1 cut(s) 608
BspPI GGATC 2 cut(s) 87, 363
BsrI ACTGG 1 cut(s) 303
BssECI CCNNGG 2 cut(s) 254, 368
BssMI GATC 2 cut(s) 79, 355
BssT1I CCWWGG 1 cut(s) 254
Bst4CI ACNGT 2 cut(s) 439, 661
BstF5I GGATG 2 cut(s) 349, 562
BstKTI GATC 2 cut(s) 82, 358
BstMBI GATC 2 cut(s) 79, 355
BstSCI CCNGG 2 cut(s) 91, 367
BstSFI CTRYAG 2 cut(s) 40, 486
Bsu15I ATCGAT 1 cut(s) 608
BsuI GTATCC 1 cut(s) 253
BsuTUI ATCGAT 1 cut(s) 608
BtsCI GGATG 2 cut(s) 349, 562
Cfr13I GGNCC 3 cut(s) 89, 365, 572
ClaI ATCGAT 1 cut(s) 608
CviAII CATG 1 cut(s) 587
CviJI RGCY 1 cut(s) 18
CviKI_1 RGCY 1 cut(s) 18
DpnI GATC 2 cut(s) 81, 357
DpnII GATC 2 cut(s) 79, 355
DraI TTTAAA 2 cut(s) 241, 457
Eco130I CCWWGG 1 cut(s) 254
Eco47I GGWCC 3 cut(s) 89, 365, 572
EcoT14I CCWWGG 1 cut(s) 254
ErhI CCWWGG 1 cut(s) 254
FaeI CATG 1 cut(s) 590
FaiI YATR 9 cut(s) 42, 71, 291, 339, 488, 588, 601, 603, 636
FalI AAGNNNNNCTT 2 cut(s) 247, 279
FatI CATG 1 cut(s) 586
Fnu4HI GCNGC 1 cut(s) 9
FokI GGATG 2 cut(s) 356, 569
Fsp4HI GCNGC 1 cut(s) 9
FspBI CTAG 3 cut(s) 15, 23, 516
GluI GCNGC 1 cut(s) 9
HapII CCGG 2 cut(s) 92, 368
Hin1II CATG 1 cut(s) 590
HincII GTYRAC 1 cut(s) 657
HindII GTYRAC 1 cut(s) 657
HpaI GTTAAC 1 cut(s) 657
HpaII CCGG 2 cut(s) 92, 368
Hpy166II GTNNAC 2 cut(s) 393, 657
Hpy188I TCNGA 1 cut(s) 316
Hpy188III TCNNGA 3 cut(s) 23, 87, 363
Hpy8I GTNNAC 2 cut(s) 393, 657
HpyAV CCTTC 1 cut(s) 29
HpyCH4III ACNGT 2 cut(s) 439, 661
HpyCH4IV ACGT 1 cut(s) 389
HpyCH4V TGCA 2 cut(s) 347, 667
HpySE526I ACGT 1 cut(s) 389
Hsp92II CATG 1 cut(s) 590
KspAI GTTAAC 1 cut(s) 657
Kzo9I GATC 2 cut(s) 79, 355
LpnPI CCDG 5 cut(s) 72, 105, 316, 348, 381
LweI GCATC 4 cut(s) 318, 334, 628, 654
MaeI CTAG 3 cut(s) 15, 23, 516
MaeII ACGT 1 cut(s) 389
MalI GATC 2 cut(s) 81, 357
MboI GATC 2 cut(s) 79, 355
MfeI CAATTG 1 cut(s) 617
MluCI AATT 7 cut(s) 34, 96, 136, 236, 293, 534, 617
MlyI GAGTC 7 cut(s) 112, 158, 167, 177, 394, 403, 423
MnlI CCTC 3 cut(s) 96, 372, 563
MseI TTAA 5 cut(s) 135, 240, 383, 456, 656
MspI CCGG 2 cut(s) 92, 368
MspR9I CCNGG 2 cut(s) 93, 369
MunI CAATTG 1 cut(s) 617
NciI CCSGG 2 cut(s) 93, 369
NdeII GATC 2 cut(s) 79, 355
NlaIII CATG 1 cut(s) 590
PfeI GAWTC 4 cut(s) 107, 443, 475, 605
PkrI GCNGC 1 cut(s) 10
PleI GAGTC 7 cut(s) 112, 158, 167, 177, 394, 403, 423
PpsI GAGTC 7 cut(s) 112, 158, 167, 177, 394, 403, 423
Psp1406I AACGTT 1 cut(s) 389
PspPI GGNCC 3 cut(s) 89, 365, 572
PsrI GAACNNNNNNTAC 4 cut(s) 67, 99, 343, 375
SaqAI TTAA 5 cut(s) 135, 240, 383, 456, 656
SatI GCNGC 1 cut(s) 9
Sau3AI GATC 2 cut(s) 79, 355
Sau96I GGNCC 3 cut(s) 89, 365, 572
SchI GAGTC 7 cut(s) 112, 158, 167, 177, 394, 403, 423
ScrFI CCNGG 2 cut(s) 93, 369
SetI ASST 4 cut(s) 16, 383, 392, 574
SfaNI GCATC 4 cut(s) 318, 334, 628, 654
SfcI CTRYAG 2 cut(s) 40, 486
SinI GGWCC 3 cut(s) 89, 365, 572
Sse9I AATT 7 cut(s) 34, 96, 136, 236, 293, 534, 617
SsiI CCGC 1 cut(s) 9
SspMI CTAG 3 cut(s) 15, 23, 516
StyD4I CCNGG 2 cut(s) 91, 367
StyI CCWWGG 1 cut(s) 254
TaaI ACNGT 2 cut(s) 439, 661
TaiI ACGT 1 cut(s) 392
TaqI TCGA 2 cut(s) 412, 608
TasI AATT 7 cut(s) 34, 96, 136, 236, 293, 534, 617
TauI GCSGC 1 cut(s) 11
TfiI GAWTC 4 cut(s) 107, 443, 475, 605
Tru1I TTAA 5 cut(s) 135, 240, 383, 456, 656
Tru9I TTAA 5 cut(s) 135, 240, 383, 456, 656
TspDTI ATGAA 1 cut(s) 618
VpaK11BI GGWCC 3 cut(s) 89, 365, 572
XapI RAATTY 3 cut(s) 34, 236, 534
XbaI TCTAGA 1 cut(s) 22
XspI CTAG 3 cut(s) 15, 23, 516
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.