pycom12g04960

No description available

Basic Information

Type: gene
Biological Identity
pyrus_communis
Chr12
Physical Location & Seq
Forward (+)
4919994 .. 4920572
579 bp
Loading structure...
UTR
Exon/CDS
Intron
pycom12g04960.3

Sequence Viewer

Length: 372 bp
ATGACACACTTGCATTCAAATCGATTTCCAGTTGCTTTTCCAATAAACCATGAACCTCAACACCCCAGATTAATCGTGAATAGGGATACGCATCGGCAACCCAAATTATTTTTCAAAACATTAAGCTTTGTGAAAATCATAAGCATTGACAAGGCATTCGTAACTATGAACAGCATGATACTCCTGCCAGGAATTTACTTAACGCGATCGTTTATAAGTGAAACTCCCTTATATTCTAGCATCAAATTCACGCATTTCTTAATCAAACAGTTAAGTAAATTTCATAATACAAATATAATCATGGTTTCAAAGTCTCCTCTAGCTAAAACAAGTTTAGCTCCTCATGTTTACAGCAAAACAAAGAGAATATAA
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families
No domains found.

Protein Analysis

124

Amino Acids

14.29

Weight (kDa)

10.71

Isoelectric Point (pI)

33.27

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AanI TTATAA 1 cut(s) 215
AccII CGCG 1 cut(s) 205
AcsI RAATTY 3 cut(s) 192, 245, 278
AgsI TTSAA 3 cut(s) 18, 115, 309
AjnI CCWGG 1 cut(s) 187
AjuI GAANNNNNNNTTGG 2 cut(s) 95, 127
AluBI AGCT 3 cut(s) 126, 323, 338
AluI AGCT 3 cut(s) 126, 323, 338
Alw26I GTCTC 1 cut(s) 318
ApoI RAATTY 3 cut(s) 192, 245, 278
ArsI GACNNNNNNTTYG 2 cut(s) 140, 172
AseI ATTAAT 1 cut(s) 71
BcgI CGANNNNNNTGC 1 cut(s) 36
BciT130I CCWGG 1 cut(s) 189
BciVI GTATCC 1 cut(s) 79
BcoDI GTCTC 1 cut(s) 318
BfaI CTAG 2 cut(s) 237, 320
BfuI GTATCC 1 cut(s) 79
Bme1390I CCNGG 1 cut(s) 189
BmrFI CCNGG 1 cut(s) 189
BmsI GCATC 2 cut(s) 100, 249
Bsa29I ATCGAT 1 cut(s) 22
BsaBI GATNNNNATC 1 cut(s) 90
Bse1I ACTGG 1 cut(s) 29
Bse8I GATNNNNATC 1 cut(s) 90
BseBI CCWGG 1 cut(s) 189
BseCI ATCGAT 1 cut(s) 22
BseJI GATNNNNATC 1 cut(s) 90
BseNI ACTGG 1 cut(s) 29
BseRI GAGGAG 2 cut(s) 306, 330
Bsh1236I CGCG 1 cut(s) 205
Bsh1285I CGRYCG 1 cut(s) 209
BshVI ATCGAT 1 cut(s) 22
BsiEI CGRYCG 1 cut(s) 209
BsmAI GTCTC 1 cut(s) 318
BsmI GAATGC 2 cut(s) 13, 155
Bsp143I GATC 1 cut(s) 206
BspDI ATCGAT 1 cut(s) 22
BspFNI CGCG 1 cut(s) 205
BsrI ACTGG 1 cut(s) 29
BssMI GATC 1 cut(s) 206
Bst2UI CCWGG 1 cut(s) 189
Bst4CI ACNGT 1 cut(s) 270
BstFNI CGCG 1 cut(s) 205
BstKTI GATC 1 cut(s) 209
BstMAI GTCTC 1 cut(s) 318
BstMBI GATC 1 cut(s) 206
BstMCI CGRYCG 1 cut(s) 209
BstNI CCWGG 1 cut(s) 189
BstSCI CCNGG 1 cut(s) 187
BstUI CGCG 1 cut(s) 205
Bsu15I ATCGAT 1 cut(s) 22
BsuI GTATCC 1 cut(s) 79
BsuTUI ATCGAT 1 cut(s) 22
ClaI ATCGAT 1 cut(s) 22
CviAII CATG 4 cut(s) 50, 175, 301, 344
CviJI RGCY 3 cut(s) 126, 323, 338
CviKI_1 RGCY 3 cut(s) 126, 323, 338
DpnI GATC 1 cut(s) 208
DpnII GATC 1 cut(s) 206
EcoRII CCWGG 1 cut(s) 187
FaeI CATG 4 cut(s) 53, 178, 304, 347
FatI CATG 4 cut(s) 49, 174, 300, 343
FspBI CTAG 2 cut(s) 237, 320
Hin1II CATG 4 cut(s) 53, 178, 304, 347
HindIII AAGCTT 1 cut(s) 124
Hpy166II GTNNAC 1 cut(s) 349
Hpy188III TCNNGA 1 cut(s) 76
Hpy8I GTNNAC 1 cut(s) 349
HpyCH4III ACNGT 1 cut(s) 270
HpyCH4V TGCA 1 cut(s) 13
Hsp92II CATG 4 cut(s) 53, 178, 304, 347
Kzo9I GATC 1 cut(s) 206
LmnI GCTCC 1 cut(s) 343
LpnPI CCDG 5 cut(s) 42, 79, 174, 197, 201
LweI GCATC 2 cut(s) 100, 249
MaeI CTAG 2 cut(s) 237, 320
MaeIII GTNAC 1 cut(s) 160
MalI GATC 1 cut(s) 208
MboI GATC 1 cut(s) 206
MluCI AATT 4 cut(s) 104, 192, 245, 278
MnlI CCTC 3 cut(s) 66, 327, 351
MseI TTAA 5 cut(s) 71, 122, 200, 260, 272
MspR9I CCNGG 1 cut(s) 189
Mva1269I GAATGC 2 cut(s) 13, 155
MvaI CCWGG 1 cut(s) 189
MvnI CGCG 1 cut(s) 205
NdeII GATC 1 cut(s) 206
NlaIII CATG 4 cut(s) 53, 178, 304, 347
PctI GAATGC 2 cut(s) 13, 155
Ple19I CGATCG 1 cut(s) 209
PshBI ATTAAT 1 cut(s) 71
PsiI TTATAA 1 cut(s) 215
Psp6I CCWGG 1 cut(s) 187
PspGI CCWGG 1 cut(s) 187
PvuI CGATCG 1 cut(s) 209
SaqAI TTAA 5 cut(s) 71, 122, 200, 260, 272
Sau3AI GATC 1 cut(s) 206
ScrFI CCNGG 1 cut(s) 189
SetI ASST 4 cut(s) 58, 128, 325, 340
SfaNI GCATC 2 cut(s) 100, 249
Sse9I AATT 4 cut(s) 104, 192, 245, 278
SspMI CTAG 2 cut(s) 237, 320
StyD4I CCNGG 1 cut(s) 187
TaaI ACNGT 1 cut(s) 270
TaqI TCGA 1 cut(s) 22
TasI AATT 4 cut(s) 104, 192, 245, 278
Tru1I TTAA 5 cut(s) 71, 122, 200, 260, 272
Tru9I TTAA 5 cut(s) 71, 122, 200, 260, 272
TspDTI ATGAA 3 cut(s) 66, 182, 272
VspI ATTAAT 1 cut(s) 71
XapI RAATTY 3 cut(s) 192, 245, 278
XspI CTAG 2 cut(s) 237, 320
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.