pycom13g25850

No description available

Basic Information

Type: gene
Biological Identity
pyrus_communis
Chr13
Physical Location & Seq
Forward (+)
22564308 .. 22565023
716 bp
Loading structure...
UTR
Exon/CDS
Intron
pycom13g25850.1

Sequence Viewer

Length: 450 bp
ATGAAAGGGGGATTGTTTTTGACGAAATTAAAACTTAAAACAGAAACTTTGCATAAAACACTTTGTAAAAACGAATTTGGGACCTATGCATATAAACCAATTTCCACGCACAATCAACCATCAGATTTTCCTTATTTCATTGAATTAGATGGAATATGCATCGCAATCAAATTATCTTTCTCAAGTTCCCTATATGAAACGCATGATAGAGATACATATCAAAAGTCATTAAGTTCTATGAAAATCATAAGCATTGACAAGGTATTCATTGATGCGATATTTATACGTATAAGTAGGGATCATACTTCAAAACACGTAAACAAAATCAAAAGACTCTTAACTAAACTTACTCTAGGACTTGACTTGGACGAAAATAGAATTGGTTTTGACTCAAAAACACTCAAACTCACAATTAGGACAGATTTGACACAACTAAATAAAGGGGATTAG
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families
No domains found.

Protein Analysis

150

Amino Acids

17.1

Weight (kDa)

9.39

Isoelectric Point (pI)

21.5

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AclWI GGATC 1 cut(s) 306
AcsI RAATTY 1 cut(s) 74
AflIII ACRYGT 1 cut(s) 313
AgsI TTSAA 2 cut(s) 143, 309
AjuI GAANNNNNNNTTGG 2 cut(s) 363, 395
AlwI GGATC 1 cut(s) 306
ApoI RAATTY 1 cut(s) 74
AspS9I GGNCC 1 cut(s) 81
AvaII GGWCC 1 cut(s) 81
BccI CCATC 2 cut(s) 127, 143
BfaI CTAG 1 cut(s) 353
Bme18I GGWCC 1 cut(s) 81
BmgT120I GGNCC 1 cut(s) 81
BmiI GGNNCC 1 cut(s) 82
BmsI GCATC 2 cut(s) 168, 262
BpuEI CTTGAG 1 cut(s) 166
BsaAI YACGTR 2 cut(s) 287, 316
BsaBI GATNNNNATC 1 cut(s) 216
Bse8I GATNNNNATC 1 cut(s) 216
BseJI GATNNNNATC 1 cut(s) 216
BslFI GGGAC 1 cut(s) 94
BsmFI GGGAC 1 cut(s) 94
Bsp143I GATC 1 cut(s) 298
BspLI GGNNCC 1 cut(s) 82
BspPI GGATC 1 cut(s) 306
BssMI GATC 1 cut(s) 298
BstBAI YACGTR 2 cut(s) 287, 316
BstKTI GATC 1 cut(s) 301
BstMBI GATC 1 cut(s) 298
BstSNI TACGTA 1 cut(s) 287
BtgZI GCGATG 1 cut(s) 145
Cfr13I GGNCC 1 cut(s) 81
CviAII CATG 1 cut(s) 203
DpnI GATC 1 cut(s) 300
DpnII GATC 1 cut(s) 298
Eco105I TACGTA 1 cut(s) 287
Eco47I GGWCC 1 cut(s) 81
EcoO109I RGGNCCY 1 cut(s) 81
EcoT22I ATGCAT 2 cut(s) 91, 161
FaeI CATG 1 cut(s) 206
FaqI GGGAC 1 cut(s) 94
FatI CATG 1 cut(s) 202
FspBI CTAG 1 cut(s) 353
Hin1II CATG 1 cut(s) 206
HinfI GANTC 2 cut(s) 333, 389
Hpy166II GTNNAC 1 cut(s) 319
Hpy188I TCNGA 1 cut(s) 124
Hpy8I GTNNAC 1 cut(s) 319
HpyCH4IV ACGT 2 cut(s) 286, 315
HpyCH4V TGCA 3 cut(s) 52, 89, 159
HpySE526I ACGT 2 cut(s) 286, 315
Hsp92II CATG 1 cut(s) 206
Kzo9I GATC 1 cut(s) 298
LweI GCATC 2 cut(s) 168, 262
MaeI CTAG 1 cut(s) 353
MaeII ACGT 2 cut(s) 286, 315
MalI GATC 1 cut(s) 300
MboI GATC 1 cut(s) 298
MluCI AATT 7 cut(s) 26, 74, 99, 143, 170, 378, 411
MlyI GAGTC 2 cut(s) 327, 383
Mph1103I ATGCAT 2 cut(s) 91, 161
MseI TTAA 4 cut(s) 29, 36, 230, 338
NdeII GATC 1 cut(s) 298
NlaIII CATG 1 cut(s) 206
NlaIV GGNNCC 1 cut(s) 82
NsiI ATGCAT 2 cut(s) 91, 161
PleI GAGTC 2 cut(s) 327, 383
PpsI GAGTC 2 cut(s) 327, 383
Ppu21I YACGTR 2 cut(s) 287, 316
PpuMI RGGWCCY 1 cut(s) 81
Psp5II RGGWCCY 1 cut(s) 81
PspN4I GGNNCC 1 cut(s) 82
PspPI GGNCC 1 cut(s) 81
PspPPI RGGWCCY 1 cut(s) 81
SaqAI TTAA 4 cut(s) 29, 36, 230, 338
Sau3AI GATC 1 cut(s) 298
Sau96I GGNCC 1 cut(s) 81
SchI GAGTC 2 cut(s) 327, 383
SetI ASST 4 cut(s) 86, 264, 289, 318
SfaNI GCATC 2 cut(s) 168, 262
SgeI CNNG 8 cut(s) 118, 195, 215, 271, 326, 365, 371, 376
SinI GGWCC 1 cut(s) 81
SmlI CTYRAG 1 cut(s) 181
SmoI CTYRAG 1 cut(s) 181
SnaBI TACGTA 1 cut(s) 287
Sse9I AATT 7 cut(s) 26, 74, 99, 143, 170, 378, 411
SspMI CTAG 1 cut(s) 353
TaiI ACGT 2 cut(s) 289, 318
TasI AATT 7 cut(s) 26, 74, 99, 143, 170, 378, 411
Tru1I TTAA 4 cut(s) 29, 36, 230, 338
Tru9I TTAA 4 cut(s) 29, 36, 230, 338
TspDTI ATGAA 5 cut(s) 17, 127, 210, 254, 256
VpaK11BI GGWCC 1 cut(s) 81
XapI RAATTY 1 cut(s) 74
XspI CTAG 1 cut(s) 353
Zsp2I ATGCAT 2 cut(s) 91, 161
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.