Prupe.5G065800_v2.0.a1

No description available

Design Primers CRISPR Design

Basic Information

Type: gene
Biological Identity
prunus_persica
Pp05
OG0000608
Physical Location & Seq
Forward (+)
8052113 .. 8052608
496 bp
Loading structure...
UTR
Exon/CDS
Intron
Prupe.5G065800.1

Sequence Viewer

Length: 210 bp
ATGGAACATATGCACACAAATCGATCTCCAGTTACTCTTTCTATAAACGATGCAATCAAATTATCCTTATTAAGTTCTCTATATGAACAGCATGATAGAGATACAAATCAAAGATCATTAAGTTATATGAAAATCATAAGCCTTGACAAGGCATTTGTAACTATGAAAAACATGATACTCCTGCCAGGAATTTACTTAACGCAATCATGA
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families
No domains found.

Protein Analysis

70

Amino Acids

7.95

Weight (kDa)

8.12

Isoelectric Point (pI)

42.25

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready
iTOL Interactive Tree Of Life · Most popular EvolView Flexible annotations MEGA Desktop phylogenetics suite FigTree Desktop tree editor

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AcsI RAATTY 1 cut(s) 189
AfiI CCNNNNNNNGG 1 cut(s) 148
AjnI CCWGG 1 cut(s) 184
ApoI RAATTY 1 cut(s) 189
ArsI GACNNNNNNTTYG 2 cut(s) 137, 169
BcgI CGANNNNNNTGC 1 cut(s) 36
BciT130I CCWGG 1 cut(s) 186
Bme1390I CCNGG 1 cut(s) 186
BmrFI CCNGG 1 cut(s) 186
BmsI GCATC 1 cut(s) 40
BpmI CTGGAG 1 cut(s) 12
Bsa29I ATCGAT 1 cut(s) 22
BsaBI GATNNNNATC 1 cut(s) 105
Bsc4I CCNNNNNNNGG 1 cut(s) 148
Bse1I ACTGG 1 cut(s) 29
Bse8I GATNNNNATC 1 cut(s) 105
BseBI CCWGG 1 cut(s) 186
BseCI ATCGAT 1 cut(s) 22
BseJI GATNNNNATC 1 cut(s) 105
BseLI CCNNNNNNNGG 1 cut(s) 148
BseNI ACTGG 1 cut(s) 29
BshVI ATCGAT 1 cut(s) 22
BslI CCNNNNNNNGG 1 cut(s) 148
Bsp143I GATC 2 cut(s) 23, 113
BspDI ATCGAT 1 cut(s) 22
BspHI TCATGA 1 cut(s) 206
BsrI ACTGG 1 cut(s) 29
BssMI GATC 2 cut(s) 23, 113
Bst2UI CCWGG 1 cut(s) 186
BstENI CCTNNNNNAGG 1 cut(s) 146
BstKTI GATC 2 cut(s) 26, 116
BstMBI GATC 2 cut(s) 23, 113
BstNI CCWGG 1 cut(s) 186
BstSCI CCNGG 1 cut(s) 184
Bsu15I ATCGAT 1 cut(s) 22
BsuTUI ATCGAT 1 cut(s) 22
CciI TCATGA 1 cut(s) 206
ClaI ATCGAT 1 cut(s) 22
CviAII CATG 3 cut(s) 92, 172, 207
CviJI RGCY 1 cut(s) 141
CviKI_1 RGCY 1 cut(s) 141
DpnI GATC 2 cut(s) 25, 115
DpnII GATC 2 cut(s) 23, 113
EcoNI CCTNNNNNAGG 1 cut(s) 146
EcoRII CCWGG 1 cut(s) 184
FaeI CATG 3 cut(s) 95, 175, 210
FatI CATG 3 cut(s) 91, 171, 206
FauNDI CATATG 1 cut(s) 9
FspEI CC 7 cut(s) 42, 79, 134, 155, 171, 194, 198
GsuI CTGGAG 1 cut(s) 12
Hin1II CATG 3 cut(s) 95, 175, 210
Hpy188III TCNNGA 1 cut(s) 207
HpyCH4V TGCA 2 cut(s) 13, 53
Hsp92II CATG 3 cut(s) 95, 175, 210
Kzo9I GATC 2 cut(s) 23, 113
LpnPI CCDG 4 cut(s) 42, 171, 194, 198
LweI GCATC 1 cut(s) 40
MaeIII GTNAC 2 cut(s) 31, 157
MalI GATC 2 cut(s) 25, 115
MboI GATC 2 cut(s) 23, 113
MluCI AATT 2 cut(s) 59, 189
MseI TTAA 3 cut(s) 71, 119, 197
MspR9I CCNGG 1 cut(s) 186
MvaI CCWGG 1 cut(s) 186
NdeI CATATG 1 cut(s) 9
NdeII GATC 2 cut(s) 23, 113
NlaIII CATG 3 cut(s) 95, 175, 210
PagI TCATGA 1 cut(s) 206
Psp6I CCWGG 1 cut(s) 184
PspGI CCWGG 1 cut(s) 184
SaqAI TTAA 3 cut(s) 71, 119, 197
Sau3AI GATC 2 cut(s) 23, 113
ScrFI CCNGG 1 cut(s) 186
SfaNI GCATC 1 cut(s) 40
SgeI CNNG 8 cut(s) 41, 104, 155, 160, 184, 193, 197, 198
Sse9I AATT 2 cut(s) 59, 189
StyD4I CCNGG 1 cut(s) 184
TaqI TCGA 1 cut(s) 22
TasI AATT 2 cut(s) 59, 189
Tru1I TTAA 3 cut(s) 71, 119, 197
Tru9I TTAA 3 cut(s) 71, 119, 197
TspDTI ATGAA 3 cut(s) 99, 143, 179
XagI CCTNNNNNAGG 1 cut(s) 146
XapI RAATTY 1 cut(s) 189
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.