pycom05g08190

No description available

Design Primers CRISPR Design

Basic Information

Type: gene
Biological Identity
pyrus_communis
Chr5
OG0000608
Physical Location & Seq
Forward (+)
10906476 .. 10906837
362 bp
Loading structure...
UTR
Exon/CDS
Intron
pycom05g08190.1

Sequence Viewer

Length: 234 bp
ATGACAATGCCTCAAATTAATCGTGAATACGACGCAATCAAATTATTCTTATCAAGTTCCCTATATGAACAACATGATAGAGATACATATCATCGATCATTAAGTTCTGTGAAAATCATAAGCATTGACAAGACATTAATAACTATGAACTGTATGGTGAAATTCCCTTACATTCTAGCATCAAATCCCTGCATGCAAACTAAGTGTGCACCCTTAATAAACATACAAGAATAA
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families
No domains found.

Protein Analysis

78

Amino Acids

8.94

Weight (kDa)

7.72

Isoelectric Point (pI)

50.5

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready
iTOL Interactive Tree Of Life · Most popular EvolView Flexible annotations MEGA Desktop phylogenetics suite FigTree Desktop tree editor

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AcsI RAATTY 1 cut(s) 161
Alw21I GWGCWC 1 cut(s) 211
Alw44I GTGCAC 1 cut(s) 207
ApaLI GTGCAC 1 cut(s) 207
ApoI RAATTY 1 cut(s) 161
AseI ATTAAT 2 cut(s) 18, 137
AsuHPI GGTGA 1 cut(s) 169
BaeGI GKGCMC 1 cut(s) 211
Bbv12I GWGCWC 1 cut(s) 211
BfaI CTAG 1 cut(s) 176
BmsI GCATC 1 cut(s) 188
Bsa29I ATCGAT 1 cut(s) 94
BsaBI GATNNNNATC 1 cut(s) 87
Bse8I GATNNNNATC 1 cut(s) 87
BseCI ATCGAT 1 cut(s) 94
BseJI GATNNNNATC 1 cut(s) 87
BseSI GKGCMC 1 cut(s) 211
BshVI ATCGAT 1 cut(s) 94
BsiHKAI GWGCWC 1 cut(s) 211
Bsp1286I GDGCHC 1 cut(s) 211
Bsp143I GATC 1 cut(s) 95
BspDI ATCGAT 1 cut(s) 94
BssMI GATC 1 cut(s) 95
Bst4CI ACNGT 1 cut(s) 152
BstC8I GCNNGC 1 cut(s) 194
BstDEI CTNAG 1 cut(s) 201
BstKTI GATC 1 cut(s) 98
BstMBI GATC 1 cut(s) 95
BstNSI RCATGY 1 cut(s) 196
BstSLI GKGCMC 1 cut(s) 211
Bsu15I ATCGAT 1 cut(s) 94
BsuTUI ATCGAT 1 cut(s) 94
Cac8I GCNNGC 1 cut(s) 194
ClaI ATCGAT 1 cut(s) 94
CseI GACGC 1 cut(s) 41
CviAII CATG 2 cut(s) 74, 193
DdeI CTNAG 1 cut(s) 201
DpnI GATC 1 cut(s) 97
DpnII GATC 1 cut(s) 95
FaeI CATG 2 cut(s) 77, 196
FaiI YATR 9 cut(s) 64, 66, 75, 88, 119, 146, 155, 194, 224
FatI CATG 2 cut(s) 73, 192
FspBI CTAG 1 cut(s) 176
HgaI GACGC 1 cut(s) 41
Hin1II CATG 2 cut(s) 77, 196
HphI GGTGA 1 cut(s) 169
Hpy166II GTNNAC 1 cut(s) 209
Hpy188III TCNNGA 1 cut(s) 23
Hpy8I GTNNAC 1 cut(s) 209
Hpy99I CGWCG 1 cut(s) 35
HpyCH4III ACNGT 1 cut(s) 152
HpyCH4V TGCA 3 cut(s) 192, 196, 209
HpyF3I CTNAG 1 cut(s) 201
Hsp92II CATG 2 cut(s) 77, 196
Kzo9I GATC 1 cut(s) 95
LpnPI CCDG 1 cut(s) 202
LweI GCATC 1 cut(s) 188
MaeI CTAG 1 cut(s) 176
MalI GATC 1 cut(s) 97
MboI GATC 1 cut(s) 95
MhlI GDGCHC 1 cut(s) 211
MluCI AATT 3 cut(s) 15, 41, 161
MnlI CCTC 1 cut(s) 21
MseI TTAA 4 cut(s) 18, 101, 137, 215
NdeII GATC 1 cut(s) 95
NlaIII CATG 2 cut(s) 77, 196
NspI RCATGY 1 cut(s) 196
PaeI GCATGC 1 cut(s) 196
PshBI ATTAAT 2 cut(s) 18, 137
SaqAI TTAA 4 cut(s) 18, 101, 137, 215
Sau3AI GATC 1 cut(s) 95
SduI GDGCHC 1 cut(s) 211
SfaNI GCATC 1 cut(s) 188
SgeI CNNG 7 cut(s) 35, 66, 86, 142, 188, 201, 205
SphI GCATGC 1 cut(s) 196
Sse9I AATT 3 cut(s) 15, 41, 161
SspMI CTAG 1 cut(s) 176
TaaI ACNGT 1 cut(s) 152
TaqI TCGA 1 cut(s) 94
TasI AATT 3 cut(s) 15, 41, 161
Tru1I TTAA 4 cut(s) 18, 101, 137, 215
Tru9I TTAA 4 cut(s) 18, 101, 137, 215
TspDTI ATGAA 2 cut(s) 81, 161
VneI GTGCAC 1 cut(s) 207
VspI ATTAAT 2 cut(s) 18, 137
XapI RAATTY 1 cut(s) 161
XceI RCATGY 1 cut(s) 196
XspI CTAG 1 cut(s) 176
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.